ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart54d12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 74 2e-10
2dbj|AP005651.3| Oryza sativa (japonica cultivar-group) genomic D... 74 2e-10
3dbj|AK105036.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 2e-10
4ref|NM_123870.1| Arabidopsis thaliana unknown protein AT5G45020 ... 44 0.14
5ref|NM_118108.5| Arabidopsis thaliana unknown protein AT4G19880 ... 44 0.14
6ref|NM_001036595.1| Arabidopsis thaliana unknown protein AT4G198... 44 0.14
7ref|NM_001036594.1| Arabidopsis thaliana unknown protein AT4G198... 44 0.14
8gb|BT000887.1| Arabidopsis thaliana clone C105363 unknown protei... 44 0.14
9gb|AF370272.1| Arabidopsis thaliana unknown protein (At4g19880) ... 44 0.14
10gb|BT000547.1| Arabidopsis thaliana unknown protein (At5g45020/... 44 0.14
11emb|AL161551.2|ATCHRIV51 Arabidopsis thaliana DNA chromosome 4, ... 44 0.14
12emb|AL024486.1|ATT16H5 Arabidopsis thaliana DNA chromosome 4, BA... 44 0.14
13gb|AF375406.1| Arabidopsis thaliana AT5g45020/K21C13_21 mRNA, co... 44 0.14
14emb|BX826752.1|CNS0A43U Arabidopsis thaliana Full-length cDNA Co... 44 0.14
15emb|BX826386.1|CNS0A40C Arabidopsis thaliana Full-length cDNA Co... 44 0.14
16emb|BX826373.1|CNS0A41Z Arabidopsis thaliana Full-length cDNA Co... 44 0.14
17emb|BX826293.1|CNS0A458 Arabidopsis thaliana Full-length cDNA Co... 44 0.14
18emb|BX827166.1|CNS0A3PD Arabidopsis thaliana Full-length cDNA Co... 44 0.14
19emb|BX828739.1|CNS0A3IB Arabidopsis thaliana Full-length cDNA Co... 44 0.14
20emb|BX830492.1|CNS0A27R Arabidopsis thaliana Full-length cDNA Co... 44 0.14
21emb|BX829570.1|CNS0A05B Arabidopsis thaliana Full-length cDNA Co... 44 0.14
22dbj|AB010693.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.14
23gb|AC152952.1| Mus musculus 6 BAC RP23-86B3 (Roswell Park Cancer... 40 2.2
24gb|AC114207.5| Rattus norvegicus 13 BAC CH230-195H16 (Children's... 40 2.2
25emb|AL031719.12|HS380F5 Human DNA sequence from clone LA16c-380F... 40 2.2
26gb|AE006467.1| Homo sapiens 16p13.3 sequence section 6 of 8 40 2.2
27gb|AC018665.9| Homo sapiens chromosome 17, clone RP11-449J21, co... 40 2.2
28gb|AC040980.14| Homo sapiens chromosome 17, clone RP11-685I11, c... 40 2.2
29gb|AC132614.3| Mus musculus BAC clone RP23-298K1 from 6, complet... 40 2.2
30ref|NM_006378.2| Homo sapiens sema domain, immunoglobulin domain... 38 8.7
31gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 38 8.7
32emb|BX571802.15| Zebrafish DNA sequence from clone CH211-197A16 ... 38 8.7
33gb|AC102248.19| Mus musculus chromosome 18, clone RP24-158I9, co... 38 8.7
34emb|AL929575.24| Human DNA sequence from clone XXyac-68G7 on chr... 38 8.7
35gb|BC054500.1| Homo sapiens sema domain, immunoglobulin domain (... 38 8.7
36gb|AC091694.9| Mus musculus Strain C57BL6/J chromosome 11 BAC, R... 38 8.7
37gb|AC013251.19| Homo sapiens 3 BAC RP11-38P22 (Roswell Park Canc... 38 8.7
38gb|AC025783.10| Oryza sativa chromosome 10 BAC OSJNBa0001O14 gen... 38 8.7
39gb|AC055840.10| Homo sapiens chromosome 18, clone RP11-645I23, c... 38 8.7
40dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 38 8.7
41dbj|AB210030.1| Homo sapiens mRNA for SEMA4D variant protein, pa... 38 8.7
42gb|AC116910.11| Homo sapiens chromosome 17, clone CTD-2573C9, co... 38 8.7
43ref|XM_342789.2| PREDICTED: Rattus norvegicus bicaudal D homolog... 38 8.7
44emb|AL935290.10| Zebrafish DNA sequence from clone CH211-270H11,... 38 8.7
45emb|BX648216.1|HSM808364 Homo sapiens mRNA; cDNA DKFZp686G03249 ... 38 8.7
46dbj|AK026659.1| Homo sapiens cDNA: FLJ23006 fis, clone LNG00414 38 8.7
47gb|U60800.1|HSU60800 Human semaphorin (CD100) mRNA, complete cds 38 8.7
48gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 38 8.7
49emb|CT010477.16| Mouse DNA sequence from clone RP23-361M19 on ch... 38 8.7
50emb|AL645542.13| Mouse DNA sequence from clone RP23-468A19 on ch... 38 8.7
51emb|AJ006945.1|HSA569 Human P2Y1 gene 38 8.7 
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                            
Query: 97       cctctctctgtcatggggagcattgtagtcgatgttggggccttgggggatgatcccgta 156
                |||||||||||| || ||||| ||||| |||||||| ||||||   ||||||||||||||
Sbjct: 12731017 cctctctctgtcgtgtggagcgttgtaatcgatgttagggcctgcagggatgatcccgta 12731076

                                     
Query: 157      ggggttgatggacgggtggct 177
                ||| || |||||||| |||||
Sbjct: 12731077 gggatttatggacggatggct 12731097
to top
>dbj|AP005651.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0086N11
          Length = 146185

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                         
Query: 97    cctctctctgtcatggggagcattgtagtcgatgttggggccttgggggatgatcccgta 156
             |||||||||||| || ||||| ||||| |||||||| ||||||   ||||||||||||||
Sbjct: 79294 cctctctctgtcgtgtggagcgttgtaatcgatgttagggcctgcagggatgatcccgta 79353

                                  
Query: 157   ggggttgatggacgggtggct 177
             ||| || |||||||| |||||
Sbjct: 79354 gggatttatggacggatggct 79374
to top
>dbj|AK105036.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-B07, full
           insert sequence
          Length = 584

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 97  cctctctctgtcatggggagcattgtagtcgatgttggggccttgggggatgatcccgta 156
           |||||||||||| || ||||| ||||| |||||||| ||||||   ||||||||||||||
Sbjct: 229 cctctctctgtcgtgtggagcgttgtaatcgatgttagggcctgcagggatgatcccgta 170

                                
Query: 157 ggggttgatggacgggtggct 177
           ||| || |||||||| |||||
Sbjct: 169 gggatttatggacggatggct 149
to top
>ref|NM_123870.1| Arabidopsis thaliana unknown protein AT5G45020 mRNA, complete cds
          Length = 1227

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 121  gtagtcgatgttggggccttgggggatgatcccg 154
            ||||||||| |||||||| || ||||||||||||
Sbjct: 1063 gtagtcgatattggggccgtgagggatgatcccg 1030
to top
>ref|NM_118108.5| Arabidopsis thaliana unknown protein AT4G19880 transcript variant
            AT4G19880.1 mRNA, complete cds
          Length = 1418

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1083 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 1026
to top
>ref|NM_001036595.1| Arabidopsis thaliana unknown protein AT4G19880 transcript variant
            AT4G19880.3 mRNA, complete cds
          Length = 1422

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1087 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 1030
to top
>ref|NM_001036594.1| Arabidopsis thaliana unknown protein AT4G19880 transcript variant
            AT4G19880.2 mRNA, complete cds
          Length = 1496

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1161 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 1104
to top
>gb|BT000887.1| Arabidopsis thaliana clone C105363 unknown protein (At4g19880) mRNA,
            complete cds
          Length = 1102

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1036 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 979
to top
>gb|AF370272.1| Arabidopsis thaliana unknown protein (At4g19880) mRNA, partial cds
          Length = 1310

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1024 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 967
to top
>gb|BT000547.1| Arabidopsis thaliana unknown protein  (At5g45020/K21C13_21) mRNA,
           complete cds
          Length = 978

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 121 gtagtcgatgttggggccttgggggatgatcccg 154
           ||||||||| |||||||| || ||||||||||||
Sbjct: 942 gtagtcgatattggggccgtgagggatgatcccg 909
to top
>emb|AL161551.2|ATCHRIV51 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 51
          Length = 197114

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                        
Query: 120    tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
              |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 174409 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 174466
to top
>emb|AL024486.1|ATT16H5 Arabidopsis thaliana DNA chromosome 4, BAC clone T16H5 (ESSAII project)
          Length = 95417

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                       
Query: 120   tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
             |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 94327 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 94384
to top
>gb|AF375406.1| Arabidopsis thaliana AT5g45020/K21C13_21 mRNA, complete cds
          Length = 1227

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 121  gtagtcgatgttggggccttgggggatgatcccg 154
            ||||||||| |||||||| || ||||||||||||
Sbjct: 1063 gtagtcgatattggggccgtgagggatgatcccg 1030
to top
>emb|BX826752.1|CNS0A43U Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB60ZC03 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1258

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1084 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 1027
to top
>emb|BX826386.1|CNS0A40C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB20ZE03 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1312

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1005 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 948
to top
>emb|BX826373.1|CNS0A41Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB1ZF10 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1308

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1077 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 1020
to top
>emb|BX826293.1|CNS0A458 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB10ZH12 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1193

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1034 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 977
to top
>emb|BX827166.1|CNS0A3PD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS19ZA10 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1358

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 120  tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
            |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 1042 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 985
to top
>emb|BX828739.1|CNS0A3IB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL34ZD01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1072

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 120 tgtagtcgatgttggggccttgggggatgatcccgtaggggttgatggacgggtggct 177
           |||| |||||||| || || || |||||||||||  | |||||||| |||||||||||
Sbjct: 963 tgtaatcgatgtttggtccatgagggatgatcccaaaagggttgatcgacgggtggct 906
to top
>emb|BX830492.1|CNS0A27R Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB85ZF11 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1611

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 121  gtagtcgatgttggggccttgggggatgatcccg 154
            ||||||||| |||||||| || ||||||||||||
Sbjct: 1447 gtagtcgatattggggccgtgagggatgatcccg 1414
to top
>emb|BX829570.1|CNS0A05B Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZG08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 535

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 121 gtagtcgatgttggggccttgggggatgatcccg 154
           ||||||||| |||||||| || ||||||||||||
Sbjct: 396 gtagtcgatattggggccgtgagggatgatcccg 363
to top
>dbj|AB010693.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21C13
          Length = 75709

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 121   gtagtcgatgttggggccttgggggatgatcccg 154
             ||||||||| |||||||| || ||||||||||||
Sbjct: 66957 gtagtcgatattggggccgtgagggatgatcccg 66924
to top
>gb|AC152952.1| Mus musculus 6 BAC RP23-86B3 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 187484

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 92     aacagcctctctctgtcatg 111
              ||||||||||||||||||||
Sbjct: 150455 aacagcctctctctgtcatg 150436
to top
>gb|AC114207.5| Rattus norvegicus 13 BAC CH230-195H16 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 216896

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 7      ggctttcagctccggacacaggca 30
              |||||||||||| |||||||||||
Sbjct: 141092 ggctttcagctctggacacaggca 141069
to top
>emb|AL031719.12|HS380F5 Human DNA sequence from clone LA16c-380F5 on chromosome 16 Contains
             part of the gene KIAA0590, ESTs, STSs, GSSs and three
             putative CpG islands, complete sequence
          Length = 44653

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 129   tgttggggccttgggggatg 148
             ||||||||||||||||||||
Sbjct: 19145 tgttggggccttgggggatg 19126
to top
>gb|AE006467.1| Homo sapiens 16p13.3 sequence section 6 of 8
          Length = 279011

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 129    tgttggggccttgggggatg 148
              ||||||||||||||||||||
Sbjct: 206961 tgttggggccttgggggatg 206942
to top
>gb|AC018665.9| Homo sapiens chromosome 17, clone RP11-449J21, complete sequence
          Length = 184393

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 21     gacacaggcaaacgaaaaccacag 44
              |||||||||||| |||||||||||
Sbjct: 141479 gacacaggcaaaggaaaaccacag 141456
to top
>gb|AC040980.14| Homo sapiens chromosome 17, clone RP11-685I11, complete sequence
          Length = 139484

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 21    gacacaggcaaacgaaaaccacag 44
             |||||||||||| |||||||||||
Sbjct: 27532 gacacaggcaaaggaaaaccacag 27509
to top
>gb|AC132614.3| Mus musculus BAC clone RP23-298K1 from 6, complete sequence
          Length = 198160

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 92   aacagcctctctctgtcatg 111
            ||||||||||||||||||||
Sbjct: 5152 aacagcctctctctgtcatg 5133
to top
>ref|NM_006378.2| Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane
            domain (TM) and short cytoplasmic domain, (semaphorin) 4D
            (SEMA4D), mRNA
          Length = 4675

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   accacagcaccctcaagca 56
            |||||||||||||||||||
Sbjct: 4302 accacagcaccctcaagca 4320
to top
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 146     atgatcccgtaggggttga 164
               |||||||||||||||||||
Sbjct: 2980542 atgatcccgtaggggttga 2980524
to top
>emb|BX571802.15| Zebrafish DNA sequence from clone CH211-197A16 in linkage group 10,
              complete sequence
          Length = 196999

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 91     gaacagcctctctctgtca 109
              |||||||||||||||||||
Sbjct: 186923 gaacagcctctctctgtca 186905
to top
>gb|AC102248.19| Mus musculus chromosome 18, clone RP24-158I9, complete sequence
          Length = 206000

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     tcagctccggacacaggca 30
              |||||||||||||||||||
Sbjct: 118900 tcagctccggacacaggca 118918
to top
>emb|AL929575.24| Human DNA sequence from clone XXyac-68G7 on chromosome 9 Contains the
             3' end of the  SECISBP2 gene for SECIS binding protein 2,
             the gene for a novel protein (LOC349236) and the 3' end of
             the SEMA4D gene for sema domain, immunoglobulin domain
             (Ig), transmembrane domain (TM) and short cytoplasmic
             domain, (semaphorin) 4D, complete sequence
          Length = 52064

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 38    accacagcaccctcaagca 56
             |||||||||||||||||||
Sbjct: 34237 accacagcaccctcaagca 34219
to top
>gb|BC054500.1| Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane
            domain (TM) and short cytoplasmic domain, (semaphorin)
            4D, mRNA (cDNA clone MGC:57659 IMAGE:5551182), complete
            cds
          Length = 4675

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   accacagcaccctcaagca 56
            |||||||||||||||||||
Sbjct: 4302 accacagcaccctcaagca 4320
to top
>gb|AC091694.9| Mus musculus Strain C57BL6/J chromosome 11 BAC, RP23-316F3, Complete
              Sequence, complete sequence
          Length = 213119

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 94     cagcctctctctgtcatgg 112
              |||||||||||||||||||
Sbjct: 163450 cagcctctctctgtcatgg 163468
to top
>gb|AC013251.19| Homo sapiens 3 BAC RP11-38P22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 176251

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 129   tgttggggccttgggggat 147
             |||||||||||||||||||
Sbjct: 65280 tgttggggccttgggggat 65298
to top
>gb|AC025783.10| Oryza sativa chromosome 10 BAC OSJNBa0001O14 genomic sequence, complete
             sequence
          Length = 178022

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 94    cagcctctctctgtcatgg 112
             |||||||||||||||||||
Sbjct: 33200 cagcctctctctgtcatgg 33218
to top
>gb|AC055840.10| Homo sapiens chromosome 18, clone RP11-645I23, complete sequence
          Length = 175293

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 137   ccttgggggatgatcccgt 155
             |||||||||||||||||||
Sbjct: 88714 ccttgggggatgatcccgt 88732
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 94       cagcctctctctgtcatgg 112
                |||||||||||||||||||
Sbjct: 20770801 cagcctctctctgtcatgg 20770819
to top
>dbj|AB210030.1| Homo sapiens mRNA for SEMA4D variant protein, partial cds, clone:
            hh05253
          Length = 5682

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   accacagcaccctcaagca 56
            |||||||||||||||||||
Sbjct: 4505 accacagcaccctcaagca 4523
to top
>gb|AC116910.11| Homo sapiens chromosome 17, clone CTD-2573C9, complete sequence
          Length = 149156

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     cagctccggacacaggcaa 31
              |||||||||||||||||||
Sbjct: 136804 cagctccggacacaggcaa 136786
to top
>ref|XM_342789.2| PREDICTED: Rattus norvegicus bicaudal D homolog 1 (Drosophila)
            (predicted) (Bicd1_predicted), mRNA
          Length = 2931

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 31   aacgaaaaccacagcaccctcaa 53
            ||||||||||||| |||||||||
Sbjct: 1486 aacgaaaaccacaacaccctcaa 1508
to top
>emb|AL935290.10| Zebrafish DNA sequence from clone CH211-270H11, complete sequence
          Length = 129665

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 91    gaacagcctctctctgtca 109
             |||||||||||||||||||
Sbjct: 21593 gaacagcctctctctgtca 21611
to top
>emb|BX648216.1|HSM808364 Homo sapiens mRNA; cDNA DKFZp686G03249 (from clone DKFZp686G03249)
          Length = 4284

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   accacagcaccctcaagca 56
            |||||||||||||||||||
Sbjct: 4094 accacagcaccctcaagca 4112
to top
>dbj|AK026659.1| Homo sapiens cDNA: FLJ23006 fis, clone LNG00414
          Length = 2106

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 129 tgttggggccttgggggat 147
           |||||||||||||||||||
Sbjct: 337 tgttggggccttgggggat 355
to top
>gb|U60800.1|HSU60800 Human semaphorin (CD100) mRNA, complete cds
          Length = 4157

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   accacagcaccctcaagca 56
            |||||||||||||||||||
Sbjct: 3817 accacagcaccctcaagca 3835
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 94       cagcctctctctgtcatgg 112
                |||||||||||||||||||
Sbjct: 20782065 cagcctctctctgtcatgg 20782083
to top
>emb|CT010477.16| Mouse DNA sequence from clone RP23-361M19 on chromosome 13, complete
              sequence
          Length = 192967

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      agataaggctttcagctcc 19
              |||||||||||||||||||
Sbjct: 115113 agataaggctttcagctcc 115095
to top
>emb|AL645542.13| Mouse DNA sequence from clone RP23-468A19 on chromosome 11, complete
             sequence
          Length = 166100

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 94    cagcctctctctgtcatgg 112
             |||||||||||||||||||
Sbjct: 66302 cagcctctctctgtcatgg 66284
to top
>emb|AJ006945.1|HSA569 Human P2Y1 gene
          Length = 16178

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 129  tgttggggccttgggggat 147
            |||||||||||||||||||
Sbjct: 8851 tgttggggccttgggggat 8869


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,178,500
Number of Sequences: 3902068
Number of extensions: 1178500
Number of successful extensions: 74913
Number of sequences better than 10.0: 51
Number of HSP's better than 10.0 without gapping: 51
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74806
Number of HSP's gapped (non-prelim): 107
length of query: 177
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 155
effective length of database: 17,147,199,772
effective search space: 2657815964660
effective search space used: 2657815964660
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top