ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart54d08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR392037.10| Zebrafish DNA sequence from clone CH211-244O22 ... 44 0.21
2gb|AC151665.26| Medicago truncatula clone mth2-7k4, complete seq... 44 0.21
3gb|AC174354.6| Medicago truncatula clone mth2-8m12, complete seq... 44 0.21
4gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 42 0.85
5emb|BX119909.5| Zebrafish DNA sequence from clone CH211-223I3 in... 42 0.85
6gb|AC109157.10| Mus musculus chromosome 7, clone RP24-169M16, co... 40 3.3
7gb|AC007321.2| Homo sapiens BAC clone RP11-507C1 from 7, complet... 40 3.3
8gb|AC146192.2| Pan troglodytes BAC clone RP43-35D13 from 7, comp... 40 3.3
9gb|AC160553.7| Mus musculus chromosome 7, clone RP23-334C12, com... 40 3.3
10emb|AL390247.11| Human DNA sequence from clone RP11-778A10 on ch... 40 3.3
11emb|AL353660.11| Human DNA sequence from clone RP11-459P23 on ch... 40 3.3
12gb|AC055758.23| Homo sapiens 3 BAC RP11-88H10 (Roswell Park Canc... 40 3.3
13emb|BX571839.8| Zebrafish DNA sequence from clone DKEY-259P7 in ... 40 3.3
14ref|XM_628609.1| Cryptosporidium parvum Iowa II Rf-A (OB fold pr... 40 3.3
15gb|AE000783.1| Borrelia burgdorferi B31, complete genome 40 3.3
16emb|BX005472.11| Zebrafish DNA sequence from clone CH211-119C22 ... 40 3.3
17emb|CR751235.5| Zebrafish DNA sequence from clone CH211-240J22 i... 40 3.3
18gb|AY874420.1| Cryptosporidium parvum replication protein A larg... 40 3.3
19gb|L32145.1|BORHTPG Borrelia burgdorferi C62.5 heat shock protei... 40 3.3
20gb|AC002988.1|AC002988 Human DNA from chromosome 19-specific cos... 40 3.3
21gb|U51878.1|BBU51878 Borrelia burgdorferi phosphotransferase enz... 40 3.3

>emb|CR392037.10| Zebrafish DNA sequence from clone CH211-244O22 in linkage group 5,
             complete sequence
          Length = 140415

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 139   atagctagaaacaaatctatcagcaa 164
             |||| |||||||||||||||||||||
Sbjct: 61872 atagatagaaacaaatctatcagcaa 61897



to top

>gb|AC151665.26| Medicago truncatula clone mth2-7k4, complete sequence
          Length = 135880

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 96    catcttttggagttgctcctta 117
             ||||||||||||||||||||||
Sbjct: 96015 catcttttggagttgctcctta 96036



to top

>gb|AC174354.6| Medicago truncatula clone mth2-8m12, complete sequence
          Length = 122859

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 96    catcttttggagttgctcctta 117
             ||||||||||||||||||||||
Sbjct: 87347 catcttttggagttgctcctta 87368



to top

>gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 25586, complete genome
          Length = 2174500

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 96     catcttttggagttgctcctt 116
              |||||||||||||||||||||
Sbjct: 515051 catcttttggagttgctcctt 515071



to top

>emb|BX119909.5| Zebrafish DNA sequence from clone CH211-223I3 in linkage group 6,
              complete sequence
          Length = 221755

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 147    aaacaaatctatcagcaacat 167
              |||||||||||||||||||||
Sbjct: 123213 aaacaaatctatcagcaacat 123193



to top

>gb|AC109157.10| Mus musculus chromosome 7, clone RP24-169M16, complete sequence
          Length = 164968

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 45     ctgattattagccttttaat 64
              ||||||||||||||||||||
Sbjct: 163603 ctgattattagccttttaat 163584



to top

>gb|AC007321.2| Homo sapiens BAC clone RP11-507C1 from 7, complete sequence
          Length = 158770

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 147   aaacaaatctatcagcaaca 166
             ||||||||||||||||||||
Sbjct: 43446 aaacaaatctatcagcaaca 43465



to top

>gb|AC146192.2| Pan troglodytes BAC clone RP43-35D13 from 7, complete sequence
          Length = 178260

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 147   aaacaaatctatcagcaaca 166
             ||||||||||||||||||||
Sbjct: 63124 aaacaaatctatcagcaaca 63143



to top

>gb|AC160553.7| Mus musculus chromosome 7, clone RP23-334C12, complete sequence
          Length = 191999

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    ctgattattagccttttaat 64
             ||||||||||||||||||||
Sbjct: 91401 ctgattattagccttttaat 91382



to top

>emb|AL390247.11| Human DNA sequence from clone RP11-778A10 on chromosome 6, complete
             sequence
          Length = 161241

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 45    ctgattattagccttttaatcaaa 68
             ||||||||||||||||||| ||||
Sbjct: 85741 ctgattattagccttttaaccaaa 85718



to top

>emb|AL353660.11| Human DNA sequence from clone RP11-459P23 on chromosome 13 Contains a
              novel gene, complete sequence
          Length = 129241

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 26     aacaaatatatttacacagc 45
              ||||||||||||||||||||
Sbjct: 121251 aacaaatatatttacacagc 121270



to top

>gb|AC055758.23| Homo sapiens 3 BAC RP11-88H10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 173456

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 198    caaaatggaattacaagtat 217
              ||||||||||||||||||||
Sbjct: 156390 caaaatggaattacaagtat 156409



to top

>emb|BX571839.8| Zebrafish DNA sequence from clone DKEY-259P7 in linkage group 16,
             complete sequence
          Length = 168648

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    caaacaaatatatttacaca 43
             ||||||||||||||||||||
Sbjct: 74616 caaacaaatatatttacaca 74597



to top

>ref|XM_628609.1| Cryptosporidium parvum Iowa II Rf-A (OB fold protein) (cgd7_4620),
            partial mRNA
          Length = 2124

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    gcccaaaagatccagtgatt 21
            ||||||||||||||||||||
Sbjct: 1047 gcccaaaagatccagtgatt 1028



to top

>gb|AE000783.1| Borrelia burgdorferi B31, complete genome
          Length = 910724

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    aatctatcagcaacattgat 171
              ||||||||||||||||||||
Sbjct: 572192 aatctatcagcaacattgat 572173



to top

>emb|BX005472.11| Zebrafish DNA sequence from clone CH211-119C22 in linkage group 11,
             complete sequence
          Length = 158170

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    tttccaaacaaatatattta 39
             ||||||||||||||||||||
Sbjct: 25020 tttccaaacaaatatattta 25001



to top

>emb|CR751235.5| Zebrafish DNA sequence from clone CH211-240J22 in linkage group 4,
             complete sequence
          Length = 104632

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    tacacagctgattattagcc 57
             ||||||||||||||||||||
Sbjct: 45374 tacacagctgattattagcc 45355



to top

>gb|AY874420.1| Cryptosporidium parvum replication protein A large subunit (RPA1B)
           gene, complete cds
          Length = 2067

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   gcccaaaagatccagtgatt 21
           ||||||||||||||||||||
Sbjct: 990 gcccaaaagatccagtgatt 971



to top

>gb|L32145.1|BORHTPG Borrelia burgdorferi C62.5 heat shock protein (htpG) gene, partial
           cds
          Length = 236

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 aatctatcagcaacattgat 171
           ||||||||||||||||||||
Sbjct: 61  aatctatcagcaacattgat 80



to top

>gb|AC002988.1|AC002988 Human DNA from chromosome 19-specific cosmid R27726, genomic sequence,
             complete sequence
          Length = 43105

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 15    agtgatttccaaacaaatatattt 38
             |||||||||||||||| |||||||
Sbjct: 29539 agtgatttccaaacaactatattt 29562



to top

>gb|U51878.1|BBU51878 Borrelia burgdorferi phosphotransferase enzyme II (crr) gene, hsp90
           (hptg) gene, complete cds
          Length = 2732

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 152 aatctatcagcaacattgat 171
           ||||||||||||||||||||
Sbjct: 947 aatctatcagcaacattgat 928


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,827,647
Number of Sequences: 3902068
Number of extensions: 2827647
Number of successful extensions: 59291
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59237
Number of HSP's gapped (non-prelim): 54
length of query: 258
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 236
effective length of database: 17,147,199,772
effective search space: 4046739146192
effective search space used: 4046739146192
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top