>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 193     gataccgatggcatccattgca 214
               ||||||||||||||||||||||
Sbjct: 5435530 gataccgatggcatccattgca 5435509

>gb|U36207.1|SSU36207 Simulium sirbanum 18S and 28S rRNA genes, partial sequence, and
           5.8S rRNA gene, complete sequence, clone 1a
          Length = 805

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 ttgcatatagcataacacttaa 231
           ||||||||||||||||||||||
Sbjct: 96  ttgcatatagcataacacttaa 75

>emb|BX465847.15| Mouse DNA sequence from clone RP23-102L14 on chromosome X, complete
             sequence
          Length = 206399

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 45    caatgtcctggactctccag 64
             ||||||||||||||||||||
Sbjct: 56539 caatgtcctggactctccag 56558


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,546,156
Number of Sequences: 3902068
Number of extensions: 2546156
Number of successful extensions: 45155
Number of sequences better than 10.0: 3
Number of HSP's better than 10.0 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45151
Number of HSP's gapped (non-prelim): 4
length of query: 286
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 264
effective length of database: 17,147,199,772
effective search space: 4526860739808
effective search space used: 4526860739808
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)