ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart54b09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESR... 44 0.043
2emb|AL512626.8| Human DNA sequence from clone RP11-163I12 on chr... 44 0.043
3gb|AY832554.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
4gb|AY832553.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
5gb|AY832552.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
6gb|AY832550.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
7gb|AY832549.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
8gb|AY832548.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
9gb|AY832547.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
10gb|AY832546.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
11gb|AY832545.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
12gb|AY832544.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
13gb|AY832542.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
14gb|AY832541.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
15gb|AY832540.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
16gb|AY832539.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
17gb|AY832538.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
18gb|AY832537.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
19gb|AY832536.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
20gb|AY832535.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
21gb|AY832533.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
22gb|AY832531.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
23gb|AY832530.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
24gb|AY832528.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 38 2.6
25ref|NM_199682.1| Danio rerio adaptor-related protein complex 1, ... 38 2.6
26gb|BC047823.1| Danio rerio adaptor-related protein complex 1, ga... 38 2.6
27ref|XM_960156.1| Neurospora crassa OR74A hypothetical protein (N... 38 2.6
28ref|XM_329391.1| Neurospora crassa OR74A hypothetical protein (N... 38 2.6
29gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 38 2.6
30dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 38 2.6
31gb|AC175319.3| Pan troglodytes BAC clone CH251-258C23 from chrom... 38 2.6
32gb|AC079995.5| Homo sapiens BAC clone RP11-629N4 from 4, complet... 38 2.6
33gb|AC174869.2| Pan troglodytes BAC clone CH251-558A1 from chromo... 38 2.6
34gb|CP000034.1| Shigella dysenteriae Sd197, complete genome 38 2.6
35gb|CP000036.1| Shigella boydii Sb227, complete genome 38 2.6
36gb|CP000038.1| Shigella sonnei Ss046, complete genome 38 2.6 
>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds
          Length = 590284

 Score = 44.1 bits (22), Expect = 0.043
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 27     acacatatacacatccggggcatgatgaac 56
              ||||||| |||||| |||||||||||||||
Sbjct: 175241 acacatacacacatgcggggcatgatgaac 175270
to top
>emb|AL512626.8| Human DNA sequence from clone RP11-163I12 on chromosome 1 Contains part
             of the ESRRG gene for  estrogen-related receptor gamma,
             complete sequence
          Length = 106859

 Score = 44.1 bits (22), Expect = 0.043
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 27    acacatatacacatccggggcatgatgaac 56
             ||||||| |||||| |||||||||||||||
Sbjct: 51240 acacatacacacatgcggggcatgatgaac 51211
to top
>gb|AY832554.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_412m1
           flavanone 3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832553.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_013d2
           flavanone 3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832552.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_013d1
           flavanone 3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832550.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_23 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832549.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_22 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832548.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_21 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832547.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_20 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832546.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_19 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832545.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_18 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832544.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_17 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832542.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_15 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832541.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_14 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832540.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_13 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832539.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_12 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832538.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_11 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832537.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_10 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832536.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_9 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832535.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_8 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832533.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_6 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832531.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_4 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832530.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_3 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>gb|AY832528.1| Pseudotsuga menziesii var. menziesii haplotype Pm-F3H1_1 flavanone
           3-hydroxylase 1 (F3H1) gene, partial cds
          Length = 365

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  acatatacacatccggggc 47
           |||||||||||||||||||
Sbjct: 335 acatatacacatccggggc 317
to top
>ref|NM_199682.1| Danio rerio adaptor-related protein complex 1, gamma 1 subunit
            (ap1g1), mRNA
          Length = 2820

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 37   acatccggggcatgatgaa 55
            |||||||||||||||||||
Sbjct: 1208 acatccggggcatgatgaa 1226
to top
>gb|BC047823.1| Danio rerio adaptor-related protein complex 1, gamma 1 subunit, mRNA
            (cDNA clone MGC:56079 IMAGE:5410195), complete cds
          Length = 2820

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 37   acatccggggcatgatgaa 55
            |||||||||||||||||||
Sbjct: 1208 acatccggggcatgatgaa 1226
to top
>ref|XM_960156.1| Neurospora crassa OR74A hypothetical protein (NCU08346.1) partial
           mRNA
          Length = 1791

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 40  tccggggcatgatgaacat 58
           |||||||||||||||||||
Sbjct: 809 tccggggcatgatgaacat 827
to top
>ref|XM_329391.1| Neurospora crassa OR74A hypothetical protein (NCU08346.1) partial
           mRNA
          Length = 1791

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 40  tccggggcatgatgaacat 58
           |||||||||||||||||||
Sbjct: 809 tccggggcatgatgaacat 827
to top
>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 50      gatgaacattatcgttatg 68
               |||||||||||||||||||
Sbjct: 1627989 gatgaacattatcgttatg 1627971
to top
>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 50      gatgaacattatcgttatg 68
               |||||||||||||||||||
Sbjct: 1631679 gatgaacattatcgttatg 1631661
to top
>gb|AC175319.3| Pan troglodytes BAC clone CH251-258C23 from chromosome unknown, complete
              sequence
          Length = 157271

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     tcatgacacatatacacat 40
              |||||||||||||||||||
Sbjct: 146039 tcatgacacatatacacat 146021
to top
>gb|AC079995.5| Homo sapiens BAC clone RP11-629N4 from 4, complete sequence
          Length = 189714

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 22    tcatgacacatatacacat 40
             |||||||||||||||||||
Sbjct: 81877 tcatgacacatatacacat 81895
to top
>gb|AC174869.2| Pan troglodytes BAC clone CH251-558A1 from chromosome unknown, complete
             sequence
          Length = 197281

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 22    tcatgacacatatacacat 40
             |||||||||||||||||||
Sbjct: 41828 tcatgacacatatacacat 41810
to top
>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 50      gatgaacattatcgttatg 68
               |||||||||||||||||||
Sbjct: 1448755 gatgaacattatcgttatg 1448773
to top
>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 50      gatgaacattatcgttatg 68
               |||||||||||||||||||
Sbjct: 1604483 gatgaacattatcgttatg 1604465
to top
>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 50      gatgaacattatcgttatg 68
               |||||||||||||||||||
Sbjct: 1668284 gatgaacattatcgttatg 1668302


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 642,899
Number of Sequences: 3902068
Number of extensions: 642899
Number of successful extensions: 73599
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73522
Number of HSP's gapped (non-prelim): 77
length of query: 68
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 47
effective length of database: 17,151,101,840
effective search space: 806101786480
effective search space used: 806101786480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top