Clone Name | rbart54a10 |
---|---|
Clone Library Name | barley_pub |
>gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds Length = 1078 Score = 379 bits (191), Expect = e-102 Identities = 278/307 (90%) Strand = Plus / Minus Query: 175 gccaaaatcaatagaactgtacgttggaccagtatgctctgtcctgctgccagtaggccg 234 ||||||||||||||||||| |||||||||||||| || ||||| || ||||||| |||| Sbjct: 850 gccaaaatcaatagaactggacgttggaccagtaagcattgtccggccgccagtacgccg 791 Query: 235 ggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggagaagg 294 ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| Sbjct: 790 ggatgacattgttggccacaagcgtcttcccggagtcgctggtgatacgcatggagaagg 731 Query: 295 gcccctgcagcccgcggctggtgtccatcctccagattgatccccaggagcggcgcatcg 354 ||||||||||| ||||||||||||||||| |||||| |||||||||||||||||||| | Sbjct: 730 gcccctgcagcgggcggctggtgtccatccgccagatggatccccaggagcggcgcattg 671 Query: 355 gctcccagtaccccgtcttgcggccgttcctggtctgcatgagctccatccgcaccacgg 414 |||||||| | ||||| ||| ||||||||||| |||||||||||||| || ||||||| Sbjct: 670 gctcccaggaacccgttgggcgcccgttcctggtttgcatgagctccatgcggaccacgg 611 Query: 415 tgccgtcgacgttggcgtactccacgagcacggcgaggtagtttgggttggagccgcgct 474 ||||||||| |||||||||||||||||| || ||||||||||| |||||||| || |||| Sbjct: 610 tgccgtcgatgttggcgtactccacgaggactgcgaggtagttggggttggatccacgct 551 Query: 475 ggacgtg 481 ||||||| Sbjct: 550 ggacgtg 544
>gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds Length = 1132 Score = 274 bits (138), Expect = 2e-70 Identities = 261/302 (86%) Strand = Plus / Minus Query: 180 aatcaatagaactgtacgttggaccagtatgctctgtcctgctgccagtaggccgggatg 239 |||||||||||||| | |||||||||||| || |||| ||||||| || ||||||||| Sbjct: 837 aatcaatagaactggaggttggaccagtaggcatggtccggctgccaataagccgggatg 778 Query: 240 acattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggagaagggcccc 299 |||||||||||||||||||||| |||| |||||||||||||| |||| ||| |||||| Sbjct: 777 gcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcgaatggcccc 718 Query: 300 tgcagcccgcggctggtgtccatcctccagattgatccccaggagcggcgcatcggctcc 359 |||||| |||| |||||||||||| |||||| || ||||| ||||||||||| || Sbjct: 717 tgcagcgggcggttggtgtccatccgccagatggagccccacgagcggcgcatatcctga 658 Query: 360 cagtaccccgtcttgcggccgttcctggtctgcatgagctccatccgcaccacggtgccg 419 |||| |||||| ||||||||| ||||||||||||||||||||||||||||||| ||| Sbjct: 657 tagtagcccgtcgggcggccgttgatggtctgcatgagctccatccgcaccacggtcccg 598 Query: 420 tcgacgttggcgtactccacgagcacggcgaggtagtttgggttggagccgcgctggacg 479 || ||||| ||||||||||||||||| ||||| ||||| ||||||||||| ||||||||| Sbjct: 597 tccacgttcgcgtactccacgagcaccgcgagatagttggggttggagccacgctggacg 538 Query: 480 tg 481 || Sbjct: 537 tg 536
>gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, complete cds Length = 939 Score = 266 bits (134), Expect = 6e-68 Identities = 260/302 (86%) Strand = Plus / Minus Query: 180 aatcaatagaactgtacgttggaccagtatgctctgtcctgctgccagtaggccgggatg 239 |||||||||||||| | |||||||||||| || |||| ||||||| || ||||||||| Sbjct: 862 aatcaatagaactggaggttggaccagtaggcatggtccggctgccaataagccgggatg 803 Query: 240 acattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggagaagggcccc 299 |||||||||||||||||||||| |||| |||||||||||||| |||| ||| |||||| Sbjct: 802 gcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcgaatggcccc 743 Query: 300 tgcagcccgcggctggtgtccatcctccagattgatccccaggagcggcgcatcggctcc 359 |||||| |||| |||||||||||| |||||| || ||||| ||||||||||| || Sbjct: 742 tgcagcgggcggttggtgtccatccgccagatggagccccacgagcggcgcatatcctga 683 Query: 360 cagtaccccgtcttgcggccgttcctggtctgcatgagctccatccgcaccacggtgccg 419 |||| ||||| ||||||||| ||||||||||||||||||||||||||||||| ||| Sbjct: 682 tagtagcccgttgggcggccgttgatggtctgcatgagctccatccgcaccacggtcccg 623 Query: 420 tcgacgttggcgtactccacgagcacggcgaggtagtttgggttggagccgcgctggacg 479 || ||||| ||||||||||||||||| ||||| ||||| ||||||||||| ||||||||| Sbjct: 622 tccacgttcgcgtactccacgagcaccgcgagatagttagggttggagccacgctggacg 563 Query: 480 tg 481 || Sbjct: 562 tg 561
>gb|U91981.1|TAU91981 Triticum aestivum pollen allergen homolog mRNA, complete cds Length = 1232 Score = 244 bits (123), Expect = 2e-61 Identities = 258/303 (85%) Strand = Plus / Minus Query: 179 aaatcaatagaactgtacgttggaccagtatgctctgtcctgctgccagtaggccgggat 238 |||||| |||||||| | ||||||||| || || |||||||||||| || |||||||| Sbjct: 868 aaatcagtagaactggaggttggaccaataggcatggtcctgctgccaataagccgggat 809 Query: 239 gacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggagaagggccc 298 | |||||||||| ||||||||||| |||| |||||||||||||| |||||||| ||||| Sbjct: 808 ggcattgttggcgaccagcgtctttccggtatcgctggtgatgcggatggagaatggccc 749 Query: 299 ctgcagcccgcggctggtgtccatcctccagattgatccccaggagcggcgcatcggctc 358 ||||| | |||| |||||||||||| ||||| || ||||| ||||||||||| || Sbjct: 748 ctgcaccgggcggttggtgtccatccgccagacggagccccacgagcggcgcatatcctg 689 Query: 359 ccagtaccccgtcttgcggccgttcctggtctgcatgagctccatccgcaccacggtgcc 418 |||||| |||||| |||||||||| | ||||||||||||||||| ||||||||||| || Sbjct: 688 ccagtagcccgtcgggcggccgttcatagtctgcatgagctccatacgcaccacggtccc 629 Query: 419 gtcgacgttggcgtactccacgagcacggcgaggtagtttgggttggagccgcgctggac 478 ||| || || |||||||||||||||| ||||| ||||| ||||||||||| |||||||| Sbjct: 628 gtccacattcacgtactccacgagcaccgcgagatagttggggttggagccacgctggac 569 Query: 479 gtg 481 ||| Sbjct: 568 gtg 566
>gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, complete cds Length = 898 Score = 172 bits (87), Expect = 7e-40 Identities = 210/251 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| | ||||||||||||||||| ||||| |||||| |||||| Sbjct: 810 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 751 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatccccagga 343 | |||||||| |||||||||| ||| |||| |||||||| |||||| | ||||| || Sbjct: 750 gagagagaaggggccctgcagccggcgcctggagtccatccgccagatggcgccccacga 691 Query: 344 gcggcgcatcggctcccagtaccccgtcttgcggccgttcctggtctgcatgagctccat 403 | ||||||||| | ||||||||||||| |||||||||||| | || |||||| ||||| Sbjct: 690 gtggcgcatcgccgtccagtaccccgtcgggcggccgttccttgactccatgaggtccat 631 Query: 404 ccgcaccacggtgccgtcgacgttggcgtactccacgagcacggcgaggtagtttgggtt 463 | ||||||||||||| || ||| ||| ||||||| |||||||| |||||||| ||||| Sbjct: 630 ctgcaccacggtgccctcccggttcgcgaactccaccagcacggccaggtagttggggtt 571 Query: 464 ggagccgcgct 474 |||||| |||| Sbjct: 570 ggagccccgct 560
>gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, complete cds Length = 1013 Score = 145 bits (73), Expect = 2e-31 Identities = 118/133 (88%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||| Sbjct: 817 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 758 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatccccagga 343 |||||||||||||||||| || | | || ||| |||||||| |||||| || |||||||| Sbjct: 757 catggagaagggcccctggaggcggtggttggagtccatccgccagatggagccccagga 698 Query: 344 gcggcgcatcggc 356 |||||||||| Sbjct: 697 ctcgcgcatcggc 685
>gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds Length = 1056 Score = 145 bits (73), Expect = 2e-31 Identities = 118/133 (88%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||| Sbjct: 849 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 790 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatccccagga 343 |||||||||||||||||| || | | || ||| |||||||| |||||| || |||||||| Sbjct: 789 catggagaagggcccctggaggcggtggttggagtccatccgccagatggagccccagga 730 Query: 344 gcggcgcatcggc 356 |||||||||| Sbjct: 729 ctcgcgcatcggc 717
>gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds Length = 810 Score = 105 bits (53), Expect = 1e-19 Identities = 101/117 (86%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||| ||||||||||||||| ||||| ||| |||||||||| Sbjct: 763 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 704 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||||| |||| || | | ||| || ||||| || |||||| |||||||| Sbjct: 703 catggagaagggcgcctggaggcggtggccggagtccagccgccagatggatcccca 647
>gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, complete cds Length = 897 Score = 99.6 bits (50), Expect = 8e-18 Identities = 71/78 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||| ||||||||||||||| ||||| ||| |||||||||| Sbjct: 790 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 731 Query: 284 catggagaagggcccctg 301 ||||||||||||| |||| Sbjct: 730 catggagaagggcgcctg 713
>emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansin B2 (expB2 gene) Length = 1194 Score = 97.6 bits (49), Expect = 3e-17 Identities = 100/117 (85%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| ||||||||||| |||||||| || ||| ||| |||||||||||||||||||| Sbjct: 850 ccagttggccgggatgatgttgttggcgacgagctgcttgccggagtcgctggtgatgcg 791 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||| ||| |||| || | | || ||| ||||||||||||||| |||||||| Sbjct: 790 catggagaatggcgcctggagacggtggttggagtccatcctccagatggatcccca 734
>gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds Length = 834 Score = 91.7 bits (46), Expect = 2e-15 Identities = 70/78 (89%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||| ||||||||||| ||| ||||| ||| |||||||||| Sbjct: 769 ccagttggccgggatgaccttgtcggccaccagcgacttgccggactcgttggtgatgcg 710 Query: 284 catggagaagggcccctg 301 ||||||||||||| |||| Sbjct: 709 catggagaagggcgcctg 692
>dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-H01, full insert sequence Length = 1794 Score = 89.7 bits (45), Expect = 8e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 |||||||||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 938 ccagtaggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 879 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 878 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 822
>gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, partial cds Length = 788 Score = 85.7 bits (43), Expect = 1e-13 Identities = 118/143 (82%) Strand = Plus / Minus Query: 220 gctgccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtga 279 ||||||||| ||||| ||||| | || |||||||||||||| ||||| ||| |||||| Sbjct: 614 gctgccagtctgccggaatgacctggtccgccaccagcgtcttgccggactcgttggtga 555 Query: 280 tgcgcatggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccc 339 ||||| ||||||||||| |||||| |||| ||||||||||||||| || || |||| Sbjct: 554 cgcgcagcgagaagggcccttgcagcggccggcgggtgtccatcctccatatggagcccc 495 Query: 340 aggagcggcgcatcggctcccag 362 |||| |||||| ||||||||| Sbjct: 494 aggactcgcgcatgggctcccag 472 Score = 58.0 bits (29), Expect = 3e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 406 gcaccacggtgccgtcgacgttggcgtactccacgagcacggcgaggtagtttgggttgg 465 |||||||| ||||||| |||| |||||||||| ||||| || |||||||| ||||||| Sbjct: 422 gcaccacgtcgccgtcgccgttctcgtactccaccagcaccgccaggtagttggggttgg 363 Query: 466 agccgcgct 474 |||| |||| Sbjct: 362 agccacgct 354
>ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB4 (OSJNBa0010C11.2), mRNA Length = 1340 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 926 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 867 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 866 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 810
>gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete cds Length = 1249 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 882 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 823 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 822 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 766
>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete sequence Length = 147117 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 16728 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 16669 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 16668 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 16612
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 21341715 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 21341656 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 21341655 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 21341599 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Plus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 ||||||||||| |||||||| || |||||||| |||||||||||| |||||| | |||| Sbjct: 21311350 gccgggatgacgttgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggag 21311409 Query: 291 aagggcccctg 301 |||||| |||| Sbjct: 21311410 aagggcgcctg 21311420 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 |||||||||||||||||||| ||||||||||| Sbjct: 20947125 acgagcacggcgaggtagttggggttggagcc 20947094 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 406 gcaccacggtgccgtcgacgttggcgtactccacgagcacggcgaggta 454 ||||||| |||||||| ||||||| ||||||| |||||||||||||| Sbjct: 21317390 gcaccaccgtgccgtccttgttggcgaactccaccagcacggcgaggta 21317438 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 326 ccagattgatccccaggagcggcgcat 352 |||||| |||||||||||||||||||| Sbjct: 21317307 ccagatggatccccaggagcggcgcat 21317333
>dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-F12, full insert sequence Length = 1290 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 939 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 880 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 879 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 823
>dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D11, full insert sequence Length = 1266 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 932 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 873 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 872 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 816
>dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033066K12, full insert sequence Length = 1883 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 1516 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 1457 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 1456 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 1400
>dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033035B15, full insert sequence Length = 1475 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 1120 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 1061 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 1060 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 1004
>dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G02, full insert sequence Length = 1293 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 938 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 879 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 878 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 822
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 21352978 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 21352919 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||||||| |||| |||| | || ||||||||| ||||||||| || ||||| Sbjct: 21352918 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcccca 21352862 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Plus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 ||||||||||| |||||||| || |||||||| |||||||||||| |||||| | |||| Sbjct: 21322614 gccgggatgacgttgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggag 21322673 Query: 291 aagggcccctg 301 |||||| |||| Sbjct: 21322674 aagggcgcctg 21322684 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 |||||||||||||||||||| ||||||||||| Sbjct: 20958389 acgagcacggcgaggtagttggggttggagcc 20958358 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 406 gcaccacggtgccgtcgacgttggcgtactccacgagcacggcgaggta 454 ||||||| |||||||| ||||||| ||||||| |||||||||||||| Sbjct: 21328654 gcaccaccgtgccgtccttgttggcgaactccaccagcacggcgaggta 21328702 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 326 ccagattgatccccaggagcggcgcat 352 |||||| |||||||||||||||||||| Sbjct: 21328571 ccagatggatccccaggagcggcgcat 21328597
>gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, complete cds Length = 1142 Score = 75.8 bits (38), Expect = 1e-10 Identities = 95/114 (83%) Strand = Plus / Minus Query: 230 ggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatgga 289 |||||||||||| || |||||||||||| | | ||||| ||| |||||||||||||||| Sbjct: 869 ggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgcatgga 810 Query: 290 gaagggcccctgcagcccgcggctggtgtccatcctccagattgatccccagga 343 |||||| || | ||| |||| ||| ||| ||||||||||| || |||||||| Sbjct: 809 gaaggggccacggagcgggcggttggggtcgatcctccagatggagccccagga 756 Score = 40.1 bits (20), Expect = 6.5 Identities = 35/40 (87%) Strand = Plus / Minus Query: 440 gagcacggcgaggtagtttgggttggagccgcgctggacg 479 ||||||||| ||||| | |||||||||||| |||||||| Sbjct: 671 gagcacggccaggtacatggggttggagccgtgctggacg 632
>gb|AY104151.1| Zea mays PCO112411 mRNA sequence Length = 1171 Score = 75.8 bits (38), Expect = 1e-10 Identities = 95/114 (83%) Strand = Plus / Minus Query: 230 ggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatgga 289 |||||||||||| || |||||||||||| | | ||||| ||| |||||||||||||||| Sbjct: 878 ggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgcatgga 819 Query: 290 gaagggcccctgcagcccgcggctggtgtccatcctccagattgatccccagga 343 |||||| || | ||| |||| ||| ||| ||||||||||| || |||||||| Sbjct: 818 gaaggggccacggagcgggcggttggggtcgatcctccagatggagccccagga 765 Score = 40.1 bits (20), Expect = 6.5 Identities = 35/40 (87%) Strand = Plus / Minus Query: 440 gagcacggcgaggtagtttgggttggagccgcgctggacg 479 ||||||||| ||||| | |||||||||||| |||||||| Sbjct: 680 gagcacggccaggtacatggggttggagccgtgctggacg 641
>gb|AY111405.1| Zea mays CL5426_1 mRNA sequence Length = 528 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| | |||||||||||||||||| ||||| ||| |||||||||| Sbjct: 299 ccagttggccgggatgacctggttggccaccagcgtcttgccggactcgttggtgatgcg 358
>ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB6 (OSJNBb0014I11.3), mRNA Length = 1240 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 ||||||||||| |||||||| || |||||||| |||||||||||| |||||| | |||| Sbjct: 875 gccgggatgacgttgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggag 816 Query: 291 aagggcccctg 301 |||||| |||| Sbjct: 815 aagggcgcctg 805
>gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete cds Length = 1210 Score = 69.9 bits (35), Expect = 7e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 258 gtcttcccggagtcgctggtgatgcgcatggagaagggcccctgcagcccgcggctggtg 317 ||||| ||||| ||| |||||||||| | ||||||||||||||||||| | || ||||| Sbjct: 958 gtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggtggttggtg 899 Query: 318 tccatcctccagattgatcccca 340 |||| |||||| || |||||||| Sbjct: 898 tccagcctccatatcgatcccca 876
>gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete cds Length = 1250 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 ||||||||||| |||||||| || |||||||| |||||||||||| |||||| | |||| Sbjct: 868 gccgggatgacgttgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggag 809 Query: 291 aagggcccctg 301 |||||| |||| Sbjct: 808 aagggcgcctg 798
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 69.9 bits (35), Expect = 7e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 258 gtcttcccggagtcgctggtgatgcgcatggagaagggcccctgcagcccgcggctggtg 317 ||||| ||||| ||| |||||||||| | ||||||||||||||||||| | || ||||| Sbjct: 169354 gtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggtggttggtg 169295 Query: 318 tccatcctccagattgatcccca 340 |||| |||||| || |||||||| Sbjct: 169294 tccagcctccatatcgatcccca 169272 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 249 gccaccagcgtcttcccggagtcgctggtgatgcgcatggagaa 292 ||||||| |||||| ||||||||||| |||||| |||||||| Sbjct: 157727 gccaccaacgtcttgccggagtcgctccggatgcggatggagaa 157770
>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0080O10, from chromosome 3, complete sequence Length = 127917 Score = 69.9 bits (35), Expect = 7e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 258 gtcttcccggagtcgctggtgatgcgcatggagaagggcccctgcagcccgcggctggtg 317 ||||| ||||| ||| |||||||||| | ||||||||||||||||||| | || ||||| Sbjct: 6421 gtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggtggttggtg 6362 Query: 318 tccatcctccagattgatcccca 340 |||| |||||| || |||||||| Sbjct: 6361 tccagcctccatatcgatcccca 6339
>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNAb0079B22, from chromosome 3, complete sequence Length = 156933 Score = 69.9 bits (35), Expect = 7e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 258 gtcttcccggagtcgctggtgatgcgcatggagaagggcccctgcagcccgcggctggtg 317 ||||| ||||| ||| |||||||||| | ||||||||||||||||||| | || ||||| Sbjct: 103354 gtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggtggttggtg 103295 Query: 318 tccatcctccagattgatcccca 340 |||| |||||| || |||||||| Sbjct: 103294 tccagcctccatatcgatcccca 103272 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 249 gccaccagcgtcttcccggagtcgctggtgatgcgcatggagaa 292 ||||||| |||||| ||||||||||| |||||| |||||||| Sbjct: 91727 gccaccaacgtcttgccggagtcgctccggatgcggatggagaa 91770
>gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 genomic sequence, complete sequence Length = 135510 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 ||||||||||| |||||||| || |||||||| |||||||||||| |||||| | |||| Sbjct: 23009 gccgggatgacgttgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggag 22950 Query: 291 aagggcccctg 301 |||||| |||| Sbjct: 22949 aagggcgcctg 22939 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 406 gcaccacggtgccgtcgacgttggcgtactccacgagcacggcgaggta 454 ||||||| |||||||| ||||||| ||||||| |||||||||||||| Sbjct: 16969 gcaccaccgtgccgtccttgttggcgaactccaccagcacggcgaggta 16921 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 326 ccagattgatccccaggagcggcgcat 352 |||||| |||||||||||||||||||| Sbjct: 17052 ccagatggatccccaggagcggcgcat 17026
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 69.9 bits (35), Expect = 7e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 258 gtcttcccggagtcgctggtgatgcgcatggagaagggcccctgcagcccgcggctggtg 317 ||||| ||||| ||| |||||||||| | ||||||||||||||||||| | || ||||| Sbjct: 169354 gtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggtggttggtg 169295 Query: 318 tccatcctccagattgatcccca 340 |||| |||||| || |||||||| Sbjct: 169294 tccagcctccatatcgatcccca 169272 Score = 48.1 bits (24), Expect = 0.027 Identities = 36/40 (90%) Strand = Plus / Minus Query: 430 cgtactccacgagcacggcgaggtagtttgggttggagcc 469 |||||||||| |||| ||| |||||||| ||||||||||| Sbjct: 24702484 cgtactccaccagcagggccaggtagttcgggttggagcc 24702445 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 249 gccaccagcgtcttcccggagtcgctggtgatgcgcatggagaa 292 ||||||| |||||| ||||||||||| |||||| |||||||| Sbjct: 157727 gccaccaacgtcttgccggagtcgctccggatgcggatggagaa 157770
>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence Length = 162241 Score = 69.9 bits (35), Expect = 7e-09 Identities = 71/83 (85%) Strand = Plus / Plus Query: 258 gtcttcccggagtcgctggtgatgcgcatggagaagggcccctgcagcccgcggctggtg 317 ||||| ||||| ||| |||||||||| | ||||||||||||||||||| | || ||||| Sbjct: 93312 gtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggtggttggtg 93371 Query: 318 tccatcctccagattgatcccca 340 |||| |||||| || |||||||| Sbjct: 93372 tccagcctccatatcgatcccca 93394 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 249 gccaccagcgtcttcccggagtcgctggtgatgcgcatggagaa 292 ||||||| |||||| ||||||||||| |||||| |||||||| Sbjct: 104939 gccaccaacgtcttgccggagtcgctccggatgcggatggagaa 104896
>dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A09, full insert sequence Length = 1257 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 ||||||||||| |||||||| || |||||||| |||||||||||| |||||| | |||| Sbjct: 888 gccgggatgacgttgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggag 829 Query: 291 aagggcccctg 301 |||||| |||| Sbjct: 828 aagggcgcctg 818
>dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A02, full insert sequence Length = 1257 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 ||||||||||| |||||||| || |||||||| |||||||||||| |||||| | |||| Sbjct: 888 gccgggatgacgttgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggag 829 Query: 291 aagggcccctg 301 |||||| |||| Sbjct: 828 aagggcgcctg 818
>dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061F13, full insert sequence Length = 1263 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 ||||||||||| |||||||| || |||||||| |||||||||||| |||||| | |||| Sbjct: 894 gccgggatgacgttgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggag 835 Query: 291 aagggcccctg 301 |||||| |||| Sbjct: 834 aagggcgcctg 824
>dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D06, full insert sequence Length = 1259 Score = 69.9 bits (35), Expect = 7e-09 Identities = 62/71 (87%) Strand = Plus / Minus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 ||||||||||| |||||||| || |||||||| |||||||||||| |||||| | |||| Sbjct: 888 gccgggatgacgttgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggag 829 Query: 291 aagggcccctg 301 |||||| |||| Sbjct: 828 aagggcgcctg 818
>dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-G02, full insert sequence Length = 1027 Score = 69.9 bits (35), Expect = 7e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 258 gtcttcccggagtcgctggtgatgcgcatggagaagggcccctgcagcccgcggctggtg 317 ||||| ||||| ||| |||||||||| | ||||||||||||||||||| | || ||||| Sbjct: 766 gtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggtggttggtg 707 Query: 318 tccatcctccagattgatcccca 340 |||| |||||| || |||||||| Sbjct: 706 tccagcctccatatcgatcccca 684
>gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence Length = 832 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 223 gccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgc 282 |||||| |||||||||||| |||||||| || |||||||| ||||| ||| || ||||| Sbjct: 264 gccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgc 205 Query: 283 gcatggagaagggc 296 | |||||||||||| Sbjct: 204 ggatggagaagggc 191
>gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, complete cds Length = 1479 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 223 gccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgc 282 |||||| |||||||||||| |||||||| || |||||||| ||||| ||| || ||||| Sbjct: 900 gccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgc 841 Query: 283 gcatggagaagggc 296 | |||||||||||| Sbjct: 840 ggatggagaagggc 827
>gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds Length = 948 Score = 67.9 bits (34), Expect = 3e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| |||||||| || |||||||| ||||| ||| || |||||| Sbjct: 839 ccagttggccgggatgaccttgttggcgacgagcgtcttgccggactcgttgcggatgcg 780 Query: 284 catggagaagggcccctg 301 |||||||||||| |||| Sbjct: 779 gatggagaagggcgcctg 762
>emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansin B3 (expB3 gene) Length = 1219 Score = 61.9 bits (31), Expect = 2e-06 Identities = 91/111 (81%) Strand = Plus / Minus Query: 230 ggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatgga 289 ||||||||||| |||| ||| || ||| ||| ||||| ||| |||||||||||||||| Sbjct: 858 ggccgggatgatcttgtcggcgacgagctgcttgccggactcgttggtgatgcgcatgga 799 Query: 290 gaagggcccctgcagcccgcggctggtgtccatcctccagattgatcccca 340 ||||||| |||| || | | || ||| |||||| | |||||| |||||||| Sbjct: 798 gaagggcgcctggaggcggtggttggagtccatgcgccagatggatcccca 748
>gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence Length = 1044 Score = 60.0 bits (30), Expect = 7e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 223 gccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgc 282 |||||| |||||||||||| |||||||| || |||||||| |||| ||| || ||||| Sbjct: 525 gccagttggccgggatgacgttgttggcgacgagcgtcttggcggactcgttgcggatgc 466 Query: 283 gcatggagaagggc 296 | |||||||||||| Sbjct: 465 ggatggagaagggc 452
>emb|AJ295940.1|FPR295940 Festuca pratensis mRNA for beta expansin B1 (expB1 gene) Length = 1224 Score = 60.0 bits (30), Expect = 7e-06 Identities = 60/70 (85%) Strand = Plus / Minus Query: 231 gccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcgcatggag 290 |||||||| ||||||||||| | ||| |||| ||||| |||||||||||||||| ||| Sbjct: 808 gccgggataacattgttggcgatgagcttcttgccggaatcgctggtgatgcgcaaggac 749 Query: 291 aagggcccct 300 || ||||||| Sbjct: 748 aatggcccct 739
>gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence Length = 477 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 genomic sequence Length = 467 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggag 269 ||||| |||||||||||| ||| |||||||||||||||| |||||| Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccggag 229
>gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, partial cds Length = 650 Score = 60.0 bits (30), Expect = 7e-06 Identities = 90/110 (81%) Strand = Plus / Minus Query: 247 tggccaccagcgtcttcccggagtcgctggtgatgcgcatggagaagggcccctgcagcc 306 ||||||||||| || | ||||| ||| |||||| ||||| ||||||||| |||| |||| Sbjct: 470 tggccaccagcttcctgccggactcgttggtgacgcgcagcgagaagggcgcctgtagcc 411 Query: 307 cgcggctggtgtccatcctccagattgatccccaggagcggcgcatcggc 356 | || ||| ||||| ||||||||| || |||||||| |||||||||| Sbjct: 410 tgtggttggcgtccagcctccagatggacccccaggactcgcgcatcggc 361
>gb|AF220610.1| Oryza sativa pollen allergen mRNA, complete cds Length = 1106 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 |||||||||||||||||||| ||||||||||| Sbjct: 602 acgagcacggcgaggtagttggggttggagcc 571
>ref|NM_197637.1| Oryza sativa (japonica cultivar-group) beta-expansin (OSJNBa0082M15.4), mRNA Length = 1148 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 |||||||||||||||||||| ||||||||||| Sbjct: 617 acgagcacggcgaggtagttggggttggagcc 586
>gb|AF261277.1| Oryza sativa beta-expansin (EXPB9) mRNA, complete cds Length = 1117 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 |||||||||||||||||||| ||||||||||| Sbjct: 617 acgagcacggcgaggtagttggggttggagcc 586
>gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 genomic sequence, complete sequence Length = 158550 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 |||||||||||||||||||| ||||||||||| Sbjct: 117266 acgagcacggcgaggtagttggggttggagcc 117297
>gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, partial cds Length = 907 Score = 56.0 bits (28), Expect = 1e-04 Identities = 118/148 (79%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| |||||||||||| || |||| || |||||||| ||||| ||| || |||||| Sbjct: 486 ccagttggccgggatgacgttcctggcgacgagcgtcttgccggactcgttgcggatgcg 427 Query: 284 catggagaagggcccctgcagcccgcggctggtgtccatcctccagattgatccccagga 343 |||||||||||| ||||| | | || |||||||||| | ||||| || |||||||| Sbjct: 426 gatggagaagggcggctgcatgcggtggttggtgtccatgcgccagacggagccccagga 367 Query: 344 gcggcgcatcggctcccagtaccccgtc 371 |||||||||| ||||| ||||||| Sbjct: 366 ctcgcgcatcggcgcccagcgccccgtc 339
>dbj|AK099112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023033P05, full insert sequence Length = 1071 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 |||||||||||||||||||| ||||||||||| Sbjct: 633 acgagcacggcgaggtagttggggttggagcc 602
>dbj|AK070187.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043G12, full insert sequence Length = 1121 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 |||||||||||||||||||| ||||||||||| Sbjct: 633 acgagcacggcgaggtagttggggttggagcc 602
>gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, complete cds Length = 1034 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Minus Query: 220 gctgccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtga 279 ||||| |||||||||||||||| | || ||| || |||| | | ||||| ||| ||||| Sbjct: 914 gctgctagtaggccgggatgacctggtcggcgacgagcgacctgccggactcgtcggtga 855 Query: 280 tgcgcatggagaagggcccctgcagc 305 ||||| |||||||||||||||||| Sbjct: 854 cgcgcagcgagaagggcccctgcagc 829
>ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB2 (OSJNBb0014I11.2), mRNA Length = 1262 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 406 gcaccacggtgccgtcgacgttggcgtactccacgagcacggcgaggta 454 ||||||| |||||||| ||||||| ||||||| |||||||||||||| Sbjct: 628 gcaccaccgtgccgtccttgttggcgaactccaccagcacggcgaggta 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 326 ccagattgatccccaggagcggcgcat 352 |||||| |||||||||||||||||||| Sbjct: 711 ccagatggatccccaggagcggcgcat 685
>gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, complete cds Length = 1173 Score = 50.1 bits (25), Expect = 0.007 Identities = 58/69 (84%) Strand = Plus / Minus Query: 224 ccagtaggccgggatgacattgttggccaccagcgtcttcccggagtcgctggtgatgcg 283 ||||| ||| |||||||||| || |||||||||||||| ||||| ||| | || ||||| Sbjct: 832 ccagttggcggggatgacatggtcagccaccagcgtcttgccggactcgttcgtaatgcg 773 Query: 284 catggagaa 292 || |||||| Sbjct: 772 cagggagaa 764
>gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, complete cds Length = 999 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 406 gcaccacggtgccgtcgacgttggcgtactccacgagcacggcgaggta 454 ||||||| |||||||| ||||||| ||||||| |||||||||||||| Sbjct: 628 gcaccaccgtgccgtccttgttggcgaactccaccagcacggcgaggta 580 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 326 ccagattgatccccaggagcggcgcat 352 |||||| |||||||||||||||||||| Sbjct: 711 ccagatggatccccaggagcggcgcat 685
>dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-F04, full insert sequence Length = 1043 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 406 gcaccacggtgccgtcgacgttggcgtactccacgagcacggcgaggta 454 ||||||| |||||||| ||||||| ||||||| |||||||||||||| Sbjct: 627 gcaccaccgtgccgtccttgttggcgaactccaccagcacggcgaggta 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 326 ccagattgatccccaggagcggcgcat 352 |||||| |||||||||||||||||||| Sbjct: 710 ccagatggatccccaggagcggcgcat 684
>dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C01, full insert sequence Length = 1259 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 406 gcaccacggtgccgtcgacgttggcgtactccacgagcacggcgaggta 454 ||||||| |||||||| ||||||| ||||||| |||||||||||||| Sbjct: 625 gcaccaccgtgccgtccttgttggcgaactccaccagcacggcgaggta 577 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 326 ccagattgatccccaggagcggcgcat 352 |||||| |||||||||||||||||||| Sbjct: 708 ccagatggatccccaggagcggcgcat 682
>gb|AF391105.1| Oryza sativa beta-expansin OsEXPB12 (EXPB12) gene, partial cds Length = 4298 Score = 48.1 bits (24), Expect = 0.027 Identities = 36/40 (90%) Strand = Plus / Minus Query: 430 cgtactccacgagcacggcgaggtagtttgggttggagcc 469 |||||||||| |||| ||| |||||||| ||||||||||| Sbjct: 2081 cgtactccaccagcagggccaggtagttcgggttggagcc 2042
>gb|AY046928.1| Oryza sativa beta-expansin (EXPB12) mRNA, complete cds Length = 1256 Score = 48.1 bits (24), Expect = 0.027 Identities = 36/40 (90%) Strand = Plus / Minus Query: 430 cgtactccacgagcacggcgaggtagtttgggttggagcc 469 |||||||||| |||| ||| |||||||| ||||||||||| Sbjct: 717 cgtactccaccagcagggccaggtagttcgggttggagcc 678
>gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, complete cds Length = 1216 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 ||||||||||| |||||||| ||||||||||| Sbjct: 815 acgagcacggccaggtagttggggttggagcc 784 Score = 42.1 bits (21), Expect = 1.6 Identities = 33/37 (89%) Strand = Plus / Minus Query: 259 tcttcccggagtcgctggtgatgcgcatggagaaggg 295 |||| ||||| |||||||||| ||| ||||||||||| Sbjct: 982 tcttgccggactcgctggtgacgcggatggagaaggg 946
>gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, complete cds Length = 1149 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 ||||||||||| |||||||| ||||||||||| Sbjct: 894 acgagcacggccaggtagttggggttggagcc 863 Score = 44.1 bits (22), Expect = 0.42 Identities = 37/42 (88%) Strand = Plus / Minus Query: 259 tcttcccggagtcgctggtgatgcgcatggagaagggcccct 300 |||| ||||| |||||||||| ||| ||||||||||| |||| Sbjct: 1061 tcttgccggactcgctggtgacgcggatggagaaggggccct 1020
>gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, complete cds Length = 1068 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 ||||||||||| |||||||| ||||||||||| Sbjct: 580 acgagcacggccaggtagttggggttggagcc 549 Score = 42.1 bits (21), Expect = 1.6 Identities = 33/37 (89%) Strand = Plus / Minus Query: 259 tcttcccggagtcgctggtgatgcgcatggagaaggg 295 |||| ||||| |||||||||| ||| ||||||||||| Sbjct: 747 tcttgccggactcgctggtgacgcggatggagaaggg 711
>gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, complete cds Length = 1111 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 ||||||||||| |||||||| ||||||||||| Sbjct: 610 acgagcacggccaggtagttggggttggagcc 579 Score = 44.1 bits (22), Expect = 0.42 Identities = 37/42 (88%) Strand = Plus / Minus Query: 259 tcttcccggagtcgctggtgatgcgcatggagaagggcccct 300 |||| ||||| |||||||||| ||| ||||||||||| |||| Sbjct: 777 tcttgccggactcgctggtgacgcggatggagaaggggccct 736
>gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, partial cds Length = 496 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 ||||||||||| |||||||| ||||||||||| Sbjct: 70 acgagcacggccaggtagttggggttggagcc 39 Score = 44.1 bits (22), Expect = 0.42 Identities = 37/42 (88%) Strand = Plus / Minus Query: 259 tcttcccggagtcgctggtgatgcgcatggagaagggcccct 300 |||| ||||| |||||||||| ||| ||||||||||| |||| Sbjct: 237 tcttgccggactcgctggtgacgcggatggagaaggggccct 196
>emb|Z68893.1|HLHOLLIGN H.lanatus mRNA for Hol l I protein Length = 1086 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 ||||||| |||||||||||| ||||||||||| Sbjct: 517 acgagcagggcgaggtagttggggttggagcc 486
>emb|Z27084.1|HLHOLLI H.lanatus mRNA for allergen Hol-lI Length = 1141 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 ||||||| |||||||||||| ||||||||||| Sbjct: 577 acgagcagggcgaggtagttggggttggagcc 546
>emb|AL713930.5|CNS07YP7 Oryza sativa chromosome 3, . BAC OSJNBa0007L18 of library OSJNBa from chromosome 3 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 183327 Score = 48.1 bits (24), Expect = 0.027 Identities = 36/40 (90%) Strand = Plus / Minus Query: 430 cgtactccacgagcacggcgaggtagtttgggttggagcc 469 |||||||||| |||| ||| |||||||| ||||||||||| Sbjct: 81173 cgtactccaccagcagggccaggtagttcgggttggagcc 81134
>gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds Length = 960 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagcc 469 ||||||||||| |||||||| ||||||||||| Sbjct: 563 acgagcacggccaggtagttggggttggagcc 532
>dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F11, full insert sequence Length = 1026 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 326 ccagattgatccccaggagcggcgcat 352 |||||| |||||||||||||||||||| Sbjct: 701 ccagatggatccccaggagcggcgcat 675 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Minus Query: 425 gttggcgtactccacgagcacggcgaggta 454 ||||||| ||||||| |||||||||||||| Sbjct: 599 gttggcgaactccaccagcacggcgaggta 570
>gb|AY197353.1| Zea mays clone pJR9 beta-expansin 1 protein (EXPB1) mRNA, complete cds Length = 1066 Score = 44.1 bits (22), Expect = 0.42 Identities = 37/42 (88%) Strand = Plus / Minus Query: 259 tcttcccggagtcgctggtgatgcgcatggagaagggcccct 300 |||| ||||| |||||||||| ||| ||||||||||| |||| Sbjct: 764 tcttgccggactcgctggtgaggcggatggagaaggggccct 723
>gb|AF332174.1|AF332174 Zea mays beta-expansin 1 (expB1) mRNA, complete cds Length = 1080 Score = 44.1 bits (22), Expect = 0.42 Identities = 37/42 (88%) Strand = Plus / Minus Query: 259 tcttcccggagtcgctggtgatgcgcatggagaagggcccct 300 |||| ||||| |||||||||| ||| ||||||||||| |||| Sbjct: 764 tcttgccggactcgctggtgaggcggatggagaaggggccct 723
>gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, partial cds Length = 671 Score = 44.1 bits (22), Expect = 0.42 Identities = 55/66 (83%) Strand = Plus / Minus Query: 416 gccgtcgacgttggcgtactccacgagcacggcgaggtagtttgggttggagccgcgctg 475 ||||||| |||| |||||||||| || | ||| ||||||| |||||||||||| |||| Sbjct: 110 gccgtcgccgttctcgtactccaccaggatggccaggtagtaggggttggagccgtgctg 51 Query: 476 gacgtg 481 ||||| Sbjct: 50 cacgtg 45
>gb|AY103636.1| Zea mays PCO124530 mRNA sequence Length = 1085 Score = 44.1 bits (22), Expect = 0.42 Identities = 37/42 (88%) Strand = Plus / Minus Query: 259 tcttcccggagtcgctggtgatgcgcatggagaagggcccct 300 |||| ||||| |||||||||| ||| ||||||||||| |||| Sbjct: 776 tcttgccggactcgctggtgaggcggatggagaaggggccct 735
>ref|XM_473433.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 795 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagccg 470 ||||||||||||| |||||| ||||| |||||| Sbjct: 551 acgagcacggcgaagtagttggggttcgagccg 519
>gb|AF391108.1| Oryza sativa beta-expansin OsEXPB15 (EXPB15) gene, complete cds Length = 4080 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagccg 470 ||||||||||||| |||||| ||||| |||||| Sbjct: 2947 acgagcacggcgaagtagttggggttcgagccg 2915
>emb|AL606633.3|OSJN00060 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0010H02, complete sequence Length = 173522 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagccg 470 ||||||||||||| |||||| ||||| |||||| Sbjct: 50850 acgagcacggcgaagtagttggggttcgagccg 50818
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 438 acgagcacggcgaggtagtttgggttggagccg 470 ||||||||||||| |||||| ||||| |||||| Sbjct: 27620221 acgagcacggcgaagtagttggggttcgagccg 27620189
>gb|AC008002.3|AC008002 Drosophila melanogaster, chromosome 2L, region 21D-21E, BAC clone BACR48E08, complete sequence Length = 182726 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 400 ccatccgcaccacggtgccgt 420 ||||||||||||||||||||| Sbjct: 108196 ccatccgcaccacggtgccgt 108216
>gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 of 83 of the complete sequence Length = 306076 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 400 ccatccgcaccacggtgccgt 420 ||||||||||||||||||||| Sbjct: 243271 ccatccgcaccacggtgccgt 243251
>gb|AC004573.1|AC004573 Drosophila melanogaster, chromosome 2L, region 21C5-21D1, P1 clone DS07610, complete sequence Length = 85095 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 400 ccatccgcaccacggtgccgt 420 ||||||||||||||||||||| Sbjct: 8701 ccatccgcaccacggtgccgt 8681
>gb|AY921647.1| Hordeum vulgare isocitrate lyase gene, promoter region and partial cds Length = 2167 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 407 caccacggtgccgtcgacgt 426 |||||||||||||||||||| Sbjct: 1704 caccacggtgccgtcgacgt 1723
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 cggagtcgctggtgatgcgc 284 |||||||||||||||||||| Sbjct: 1636891 cggagtcgctggtgatgcgc 1636910
>ref|NM_192028.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2925 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 315 gtgtccatcctccagattga 334 |||||||||||||||||||| Sbjct: 2039 gtgtccatcctccagattga 2020
>gb|AY268139.1| Hordeum vulgare BAC 184G9, complete sequece Length = 120562 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ttacattgtacaaggcctta 107 |||||||||||||||||||| Sbjct: 75992 ttacattgtacaaggcctta 75973
>ref|XM_597877.2| PREDICTED: Bos taurus similar to ADAM metallopeptidase domain 8 precursor (LOC519652), mRNA Length = 2937 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 349 gcatcggctcccagtacccc 368 |||||||||||||||||||| Sbjct: 1085 gcatcggctcccagtacccc 1104
>gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds Length = 933 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 249 gccaccagcgtcttcccggagtcgctggtgatgcgcatggagaa 292 ||||||| |||||| ||||||||||| |||||| |||||||| Sbjct: 746 gccaccaacgtcttgccggagtcgctccggatgcggatggagaa 703
>gb|AC105937.2| Homo sapiens chromosome 3 clone RP11-45J19, complete sequence Length = 171621 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 acaatgaacgagaggagaaa 133 |||||||||||||||||||| Sbjct: 19420 acaatgaacgagaggagaaa 19401
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 315 gtgtccatcctccagattga 334 |||||||||||||||||||| Sbjct: 27891564 gtgtccatcctccagattga 27891545
>gb|AC011743.9| Homo sapiens BAC clone RP11-299O14 from 2, complete sequence Length = 114495 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 acaatgaacgagaggagaaa 133 |||||||||||||||||||| Sbjct: 53750 acaatgaacgagaggagaaa 53731
>dbj|AP003335.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1144G04 Length = 194459 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 315 gtgtccatcctccagattga 334 |||||||||||||||||||| Sbjct: 78245 gtgtccatcctccagattga 78226
>dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069H18, full insert sequence Length = 1019 Score = 40.1 bits (20), Expect = 6.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 249 gccaccagcgtcttcccggagtcgctggtgatgcgcatggagaa 292 ||||||| |||||| ||||||||||| |||||| |||||||| Sbjct: 828 gccaccaacgtcttgccggagtcgctccggatgcggatggagaa 785
>gb|AC112493.2| Homo sapiens X BAC RP11-2M5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 164480 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 gttcctatagaccttgcatt 89 |||||||||||||||||||| Sbjct: 55188 gttcctatagaccttgcatt 55207
>dbj|AP005204.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-340P19, complete sequence Length = 157244 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 aggtaattaggccaaaatca 184 |||||||||||||||||||| Sbjct: 85932 aggtaattaggccaaaatca 85913 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,308,235 Number of Sequences: 3902068 Number of extensions: 3308235 Number of successful extensions: 52931 Number of sequences better than 10.0: 114 Number of HSP's better than 10.0 without gapping: 114 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 52559 Number of HSP's gapped (non-prelim): 371 length of query: 481 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 459 effective length of database: 17,147,199,772 effective search space: 7870564695348 effective search space used: 7870564695348 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)