ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart54a06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000025.1| Campylobacter jejuni RM1221, complete genome 40 6.7
2ref|NM_122730.1| Arabidopsis thaliana transporter AT5G28470 mRNA... 40 6.7
3gb|AY809038.1| Schistosoma japonicum SJCHGC03874 protein mRNA, p... 40 6.7
4gb|AC073101.7| Homo sapiens BAC clone RP11-445E22 from 7, comple... 40 6.7
5gb|AC138116.4| Mus musculus BAC clone RP24-242H5 from chromosome... 40 6.7
6gb|AC122339.3| Mus musculus BAC clone RP23-353L10 from chromosom... 40 6.7
7gb|DQ446993.1| Arabidopsis thaliana clone pENTR221-At5g28470 pro... 40 6.7
8gb|AC134420.8| Mus musculus chromosome 15, clone RP23-478J5, com... 40 6.7
9gb|AC162465.3| Mus musculus 6 BAC RP24-108G5 (Roswell Park Cance... 40 6.7
10gb|AC023403.9| Homo sapiens chromosome 8, clone RP11-563N12, com... 40 6.7
11dbj|AK143842.1| Mus musculus 6 days neonate spleen cDNA, RIKEN f... 40 6.7
12gb|AC155238.2| Mus musculus BAC clone RP24-445E24 from chromosom... 40 6.7
13dbj|AK041150.1| Mus musculus adult male aorta and vein cDNA, RIK... 40 6.7
14gb|AF262039.1|F24J2 Arabidopsis thaliana BAC F24J2 40 6.7
15gb|AC158657.2| Mus musculus 6 BAC RP23-395C12 (Roswell Park Canc... 40 6.7
16gb|BC091230.1| Rattus norvegicus neuropathy target esterase like... 40 6.7
17emb|CT030196.9| Mouse DNA sequence from clone RP23-282B14 on chr... 40 6.7

>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome
          Length = 1777831

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 83      ttaacaaaatatacagacta 102
               ||||||||||||||||||||
Sbjct: 1362743 ttaacaaaatatacagacta 1362724



to top

>ref|NM_122730.1| Arabidopsis thaliana transporter AT5G28470 mRNA, complete cds
          Length = 1686

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 91  atatacagactaacatcagt 110
           ||||||||||||||||||||
Sbjct: 596 atatacagactaacatcagt 615



to top

>gb|AY809038.1| Schistosoma japonicum SJCHGC03874 protein mRNA, partial cds
          Length = 764

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 365 gcagaaaaaagcatggaaca 384
           ||||||||||||||||||||
Sbjct: 679 gcagaaaaaagcatggaaca 660



to top

>gb|AC073101.7| Homo sapiens BAC clone RP11-445E22 from 7, complete sequence
          Length = 96699

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 396   gtctttggctagctttaatg 415
             ||||||||||||||||||||
Sbjct: 86233 gtctttggctagctttaatg 86252



to top

>gb|AC138116.4| Mus musculus BAC clone RP24-242H5 from chromosome 15, complete sequence
          Length = 164014

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 367   agaaaaaagcatggaacatg 386
             ||||||||||||||||||||
Sbjct: 93185 agaaaaaagcatggaacatg 93204



to top

>gb|AC122339.3| Mus musculus BAC clone RP23-353L10 from chromosome 5, complete sequence
          Length = 203685

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   tgtcctgtcactcaaaccac 304
             ||||||||||||||||||||
Sbjct: 54447 tgtcctgtcactcaaaccac 54466



to top

>gb|DQ446993.1| Arabidopsis thaliana clone pENTR221-At5g28470 proton-dependent
           oligopeptide transport family protein (At5g28470) mRNA,
           complete cds
          Length = 1680

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 91  atatacagactaacatcagt 110
           ||||||||||||||||||||
Sbjct: 596 atatacagactaacatcagt 615



to top

>gb|AC134420.8| Mus musculus chromosome 15, clone RP23-478J5, complete sequence
          Length = 190455

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 367    agaaaaaagcatggaacatg 386
              ||||||||||||||||||||
Sbjct: 140353 agaaaaaagcatggaacatg 140334



to top

>gb|AC162465.3| Mus musculus 6 BAC RP24-108G5 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 203546

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 294   actcaaaccacccagaaaca 313
             ||||||||||||||||||||
Sbjct: 88896 actcaaaccacccagaaaca 88877



to top

>gb|AC023403.9| Homo sapiens chromosome 8, clone RP11-563N12, complete sequence
          Length = 193461

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 304    cccagaaacatcgcatcatcgccctgga 331
              |||||||||||| |||||| ||||||||
Sbjct: 167010 cccagaaacatctcatcattgccctgga 166983



to top

>dbj|AK143842.1| Mus musculus 6 days neonate spleen cDNA, RIKEN full-length enriched
           library, clone:F430204C11 product:hypothetical protein,
           full insert sequence
          Length = 2112

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 294 actcaaaccacccagaaaca 313
           ||||||||||||||||||||
Sbjct: 410 actcaaaccacccagaaaca 429



to top

>gb|AC155238.2| Mus musculus BAC clone RP24-445E24 from chromosome 12, complete
             sequence
          Length = 128680

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   ggatggtgcttccaacaggt 460
             ||||||||||||||||||||
Sbjct: 18888 ggatggtgcttccaacaggt 18869



to top

>dbj|AK041150.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length
           enriched library, clone:A530085O15 product:weakly
           similar to ALDEHYDE DEHYDROGENASE 8 (EC 1.2.1.5) [Homo
           sapiens], full insert sequence
          Length = 2151

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 48  ggcaaacattctcgacgatgccta 71
           |||||||||||||||||| |||||
Sbjct: 670 ggcaaacattctcgacgacgccta 693



to top

>gb|AF262039.1|F24J2 Arabidopsis thaliana BAC F24J2
          Length = 80472

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 91    atatacagactaacatcagt 110
             ||||||||||||||||||||
Sbjct: 41610 atatacagactaacatcagt 41629



to top

>gb|AC158657.2| Mus musculus 6 BAC RP23-395C12 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 202215

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 294   actcaaaccacccagaaaca 313
             ||||||||||||||||||||
Sbjct: 53389 actcaaaccacccagaaaca 53408



to top

>gb|BC091230.1| Rattus norvegicus neuropathy target esterase like 1, mRNA (cDNA clone
            MGC:108975 IMAGE:7321805), complete cds
          Length = 4472

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 462  cttgtcctcatcaccctcat 481
            ||||||||||||||||||||
Sbjct: 3257 cttgtcctcatcaccctcat 3276



to top

>emb|CT030196.9| Mouse DNA sequence from clone RP23-282B14 on chromosome 12, complete
              sequence
          Length = 215752

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    ggatggtgcttccaacaggt 460
              ||||||||||||||||||||
Sbjct: 121045 ggatggtgcttccaacaggt 121064


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,549,022
Number of Sequences: 3902068
Number of extensions: 4549022
Number of successful extensions: 84230
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 84193
Number of HSP's gapped (non-prelim): 37
length of query: 496
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 474
effective length of database: 17,147,199,772
effective search space: 8127772691928
effective search space used: 8127772691928
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top