ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart54a02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC132470.3| Mus musculus BAC clone RP23-96F5 from chromosome ... 44 0.42
2gb|AC151831.3| Mus musculus BAC clone RP24-81D24 from chromosome... 44 0.42
3ref|XM_787479.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.6
4emb|BX072539.13| Zebrafish DNA sequence from clone CH211-286O24 ... 40 6.6
5gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 6.6
6ref|NM_211260.1| Eremothecium gossypii AFR358Wp (AFR358W), mRNA 40 6.6
7gb|AC160640.2| Gallus gallus BAC clone CH261-166L21 from chromos... 40 6.6

>gb|AC132470.3| Mus musculus BAC clone RP23-96F5 from chromosome 14, complete sequence
          Length = 206002

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 427   acactttcttgtcaatcacatt 448
             ||||||||||||||||||||||
Sbjct: 67764 acactttcttgtcaatcacatt 67785



to top

>gb|AC151831.3| Mus musculus BAC clone RP24-81D24 from chromosome 14, complete sequence
          Length = 212749

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 427   acactttcttgtcaatcacatt 448
             ||||||||||||||||||||||
Sbjct: 10302 acactttcttgtcaatcacatt 10281



to top

>ref|XM_787479.1| PREDICTED: Strongylocentrotus purpuratus similar to CG3973-PA
           (LOC587769), mRNA
          Length = 2124

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 446 attctgatagtactgcttat 465
           ||||||||||||||||||||
Sbjct: 557 attctgatagtactgcttat 576



to top

>emb|BX072539.13| Zebrafish DNA sequence from clone CH211-286O24 in linkage group 6,
             complete sequence
          Length = 78217

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 442   tcacattctgatagtactgcttat 465
             ||||||||||||||||||| ||||
Sbjct: 57030 tcacattctgatagtactgattat 57007



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
               complete sequence
          Length = 1813164

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 406     gcacggcgtccgaggtgaac 425
               ||||||||||||||||||||
Sbjct: 1088383 gcacggcgtccgaggtgaac 1088402



to top

>ref|NM_211260.1| Eremothecium gossypii AFR358Wp (AFR358W), mRNA
          Length = 1242

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 406 gcacggcgtccgaggtgaac 425
           ||||||||||||||||||||
Sbjct: 653 gcacggcgtccgaggtgaac 672



to top

>gb|AC160640.2| Gallus gallus BAC clone CH261-166L21 from chromosome unknown, complete
             sequence
          Length = 233376

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 115   tacataattttagtataagaaaac 138
             ||||| ||||||||||||||||||
Sbjct: 90407 tacatcattttagtataagaaaac 90430


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,663,474
Number of Sequences: 3902068
Number of extensions: 3663474
Number of successful extensions: 63772
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63753
Number of HSP's gapped (non-prelim): 19
length of query: 488
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 466
effective length of database: 17,147,199,772
effective search space: 7990595093752
effective search space used: 7990595093752
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top