>gb|AC154766.2| Mus musculus BAC clone RP24-440G8 from chromosome 17, complete sequence
          Length = 166224

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 12    aggtgacttgactccttacatga 34
             |||||| ||||||||||||||||
Sbjct: 96573 aggtgatttgactccttacatga 96551

>emb|AL118557.5|CNS01DRT Human chromosome 14 DNA sequence BAC R-1033H12 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 214175

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    ccttacatgaattaactca 43
             |||||||||||||||||||
Sbjct: 41372 ccttacatgaattaactca 41354

>dbj|AP000752.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-689N19, complete
             sequence
          Length = 194140

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    ccttacatgaattaactca 43
             |||||||||||||||||||
Sbjct: 37021 ccttacatgaattaactca 37039

>emb|AL731810.20| Mouse DNA sequence from clone RP23-465B20 on chromosome 4, complete
              sequence
          Length = 173609

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 3      gtccagaccaggtgacttg 21
              |||||||||||||||||||
Sbjct: 122633 gtccagaccaggtgacttg 122615

>ref|XM_857407.1| PREDICTED: Canis familiaris similar to epithelial cell transforming
            sequence 2 oncogene protein, transcript variant 3
            (LOC488172), mRNA
          Length = 3237

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 27   ttacatgaattaactcaa 44
            ||||||||||||||||||
Sbjct: 3127 ttacatgaattaactcaa 3110

>gb|AC122268.5| Mus musculus BAC clone RP23-216B15 from 14, complete sequence
          Length = 207136

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    ccaggtgacttgactcct 27
             ||||||||||||||||||
Sbjct: 97752 ccaggtgacttgactcct 97769

>emb|CR956381.6| Pig DNA sequence from clone CH242-248C21 on chromosome 17, complete
             sequence
          Length = 58781

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 18    cttgactccttacatgaa 35
             ||||||||||||||||||
Sbjct: 54966 cttgactccttacatgaa 54983

>gb|AC092265.3| Homo sapiens chromosome 1 clone RP4-656G21, complete sequence
          Length = 129231

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 15     tgacttgactccttacat 32
              ||||||||||||||||||
Sbjct: 103464 tgacttgactccttacat 103447

>emb|AL136135.19| Human DNA sequence from clone RP11-301C18 on chromosome 6 Contains the
             5'end of a  gene for a novel protein (2410004N11RIK), the
             gene for a novel protein, the 5' end of a gene for a novel
             protein and a CpG island, complete sequence
          Length = 46699

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 27    ttacatgaattaactcaa 44
             ||||||||||||||||||
Sbjct: 16146 ttacatgaattaactcaa 16129

>emb|AL034431.16|HS970A17 Human DNA sequence from clone RP5-970A17 on chromosome 20 Contains
             STSs, GSSs and genomic marker D20S850, complete sequence
          Length = 82906

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 27    ttacatgaattaactcaa 44
             ||||||||||||||||||
Sbjct: 31456 ttacatgaattaactcaa 31473

>gb|AC069256.15| Homo sapiens 3 BAC RP11-445G6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 149986

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 25     ccttacatgaattaactc 42
              ||||||||||||||||||
Sbjct: 107767 ccttacatgaattaactc 107750

>gb|AC092944.14| Homo sapiens 3 BAC RP11-550I24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 184688

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 25    ccttacatgaattaactc 42
             ||||||||||||||||||
Sbjct: 45772 ccttacatgaattaactc 45789

>emb|BX276102.11| Zebrafish DNA sequence from clone CH211-268M12 in linkage group 5,
             complete sequence
          Length = 55896

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 24    tccttacatgaattaact 41
             ||||||||||||||||||
Sbjct: 29517 tccttacatgaattaact 29500

>gb|AC055866.19| Homo sapiens chromosome 17, clone RP11-376M2, complete sequence
          Length = 204746

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 25     ccttacatgaattaactc 42
              ||||||||||||||||||
Sbjct: 189352 ccttacatgaattaactc 189335


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 308,222
Number of Sequences: 3902068
Number of extensions: 308222
Number of successful extensions: 65130
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65107
Number of HSP's gapped (non-prelim): 23
length of query: 45
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 25
effective length of database: 17,155,003,908
effective search space: 428875097700
effective search space used: 428875097700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)