ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart53g09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, com... 220 2e-54
2gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds 198 9e-48
3gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds 196 4e-47
4gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds 133 4e-28
5ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-exp... 117 3e-23
6gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete... 117 3e-23
7gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 geno... 117 3e-23
8dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 117 3e-23
9dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
10dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
11dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
12dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
13dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
14gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 117 3e-23
15gb|AY111405.1| Zea mays CL5426_1 mRNA sequence 113 4e-22
16gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence 111 2e-21
17emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansi... 111 2e-21
18gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, co... 111 2e-21
19gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence 103 4e-19
20gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, pa... 103 4e-19
21gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, co... 100 6e-18
22gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, com... 94 4e-16
23gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds 94 4e-16
24gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, pa... 82 1e-12
25gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, pa... 78 2e-11
26ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-exp... 74 4e-10
27gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete... 74 4e-10
28gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 gen... 74 4e-10
29dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
30dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
31dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
32dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
33gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 70 5e-09
34gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare str... 70 5e-09
35gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare str... 70 5e-09
36dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 70 5e-09
37gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence 70 5e-09
38dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 5e-09
39gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete... 66 9e-08
40gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence 66 9e-08
41gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 ge... 66 9e-08
42gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 ge... 66 9e-08
43gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 ge... 66 9e-08
44gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 ge... 66 9e-08
45gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 ge... 66 9e-08
46gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 ge... 66 9e-08
47gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 ge... 66 9e-08
48gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 ge... 66 9e-08
49gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 ge... 66 9e-08
50gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 ge... 66 9e-08
51gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 ge... 66 9e-08
52gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 ge... 66 9e-08
53gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 ge... 66 9e-08
54gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 ge... 66 9e-08
55gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 ge... 66 9e-08
56gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 ge... 66 9e-08
57gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 geno... 66 9e-08
58ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-exp... 64 3e-07
59gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete... 64 3e-07
60dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 3e-07
61dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 3e-07
62dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 3e-07
63gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, com... 58 2e-05
64dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
65emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansi... 54 3e-04
66gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, co... 54 3e-04
67gb|AY104151.1| Zea mays PCO112411 mRNA sequence 54 3e-04
68gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, parti... 52 0.001
69gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds 50 0.005
70gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, com... 48 0.020
71emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 prote... 46 0.079
72dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, parti... 44 0.31
73gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds 44 0.31
74gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 42 1.2
75gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete se... 42 1.2
76emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome... 42 1.2
77emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 42 1.2
78gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complet... 42 1.2
79gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, com... 42 1.2
80gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds 42 1.2
81gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 4.9
82ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-exp... 40 4.9
83gb|AY172516.1| Rhizobium etli transcription repair coupling fact... 40 4.9
84gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 4.9
85gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 4.9
86gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, comp... 40 4.9
87gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 4.9
88gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, co... 40 4.9
89dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
90emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in ... 40 4.9
91dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
92dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
93gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, co... 40 4.9
94gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 ... 40 4.9
95gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-... 40 4.9
96gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-... 40 4.9
97gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 4.9
98gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type... 40 4.9 
>gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, complete cds
          Length = 897

 Score =  220 bits (111), Expect = 2e-54
 Identities = 148/160 (92%), Gaps = 9/160 (5%)
 Strand = Plus / Minus

                                                                       
Query: 216 gataccaaatctagccaatgtatgcatatgattccaaatgatga-------tgagttcag 268
           ||||||||||| |||||||| ||||||  |||||||||||||||       | |||||||
Sbjct: 895 gataccaaatcaagccaatgcatgcat--gattccaaatgatgagttcggttcagttcag 838

                                                                       
Query: 269 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 328
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 837 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 778

                                                   
Query: 329 atgaccttgtcggccaccagcgtcttgccggactcgttgg 368
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 777 atgaccttgtcggccaccagcgtcttgccggactcgttgg 738
to top
>gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds
          Length = 810

 Score =  198 bits (100), Expect = 9e-48
 Identities = 100/100 (100%)
 Strand = Plus / Minus

                                                                       
Query: 269 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 328
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 810 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 751

                                                   
Query: 329 atgaccttgtcggccaccagcgtcttgccggactcgttgg 368
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 750 atgaccttgtcggccaccagcgtcttgccggactcgttgg 711
to top
>gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds
          Length = 834

 Score =  196 bits (99), Expect = 4e-47
 Identities = 105/107 (98%)
 Strand = Plus / Minus

                                                                       
Query: 262 agttcagcagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagtt 321
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 823 agttcagcagcttcagctgtactggacgatggaacggtagaaggtgctgggcgcccagtt 764

                                                          
Query: 322 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgttgg 368
           ||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 763 ggccgggatgaccttgtcggccaccagcgacttgccggactcgttgg 717
to top
>gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds
          Length = 948

 Score =  133 bits (67), Expect = 4e-28
 Identities = 88/95 (92%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||||||| |||||  |||||||||||||||||
Sbjct: 882 ttcagctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatga 823

                                              
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttg 367
           |||||| ||| || |||||||||||||||||||||
Sbjct: 822 ccttgttggcgacgagcgtcttgccggactcgttg 788
to top
>ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB4
           (OSJNBa0010C11.2), mRNA
          Length = 1340

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 969 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 910

                                              
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttg 367
           | |||| ||| || |||||||||||||||||||||
Sbjct: 909 cgttgttggcgacgagcgtcttgccggactcgttg 875
to top
>gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete cds
          Length = 1249

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 925 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 866

                                              
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttg 367
           | |||| ||| || |||||||||||||||||||||
Sbjct: 865 cgttgttggcgacgagcgtcttgccggactcgttg 831
to top
>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete
             sequence
          Length = 147117

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                         
Query: 273   ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
             |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 16771 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 16712

                                                
Query: 333   ccttgtcggccaccagcgtcttgccggactcgttg 367
             | |||| ||| || |||||||||||||||||||||
Sbjct: 16711 cgttgttggcgacgagcgtcttgccggactcgttg 16677



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                        
Query: 277  gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
            ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 4068 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 4127

                                            
Query: 337  gtcggccaccagcgtcttgccggactcgttgg 368
            |  ||| || |||  |||||||||||||||||
Sbjct: 4128 gctggcgacgagctgcttgccggactcgttgg 4159
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                            
Query: 273      ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
                |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 21341758 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21341699

                                                   
Query: 333      ccttgtcggccaccagcgtcttgccggactcgttg 367
                | |||| ||| || |||||||||||||||||||||
Sbjct: 21341698 cgttgttggcgacgagcgtcttgccggactcgttg 21341664



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                            
Query: 276      agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
                ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 21311303 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21311362

                                         
Query: 336      tgtcggccaccagcgtcttgccgga 360
                ||| ||| || ||||||||||||||
Sbjct: 21311363 tgttggcgacgagcgtcttgccgga 21311387



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                            
Query: 277      gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
                ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 21329054 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21329113

                                                
Query: 337      gtcggccaccagcgtcttgccggactcgttgg 368
                |  ||| || |||  |||||||||||||||||
Sbjct: 21329114 gctggcgacgagctgcttgccggactcgttgg 21329145



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 316      ccagttggccgggatgacct 335
                ||||||||||||||||||||
Sbjct: 21317205 ccagttggccgggatgacct 21317224
to top
>dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-F12, full
           insert sequence
          Length = 1290

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 982 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 923

                                              
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttg 367
           | |||| ||| || |||||||||||||||||||||
Sbjct: 922 cgttgttggcgacgagcgtcttgccggactcgttg 888
to top
>dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D11, full
           insert sequence
          Length = 1266

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 975 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 916

                                              
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttg 367
           | |||| ||| || |||||||||||||||||||||
Sbjct: 915 cgttgttggcgacgagcgtcttgccggactcgttg 881
to top
>dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033066K12, full
            insert sequence
          Length = 1883

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                        
Query: 273  ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
            |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 1559 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1500

                                               
Query: 333  ccttgtcggccaccagcgtcttgccggactcgttg 367
            | |||| ||| || |||||||||||||||||||||
Sbjct: 1499 cgttgttggcgacgagcgtcttgccggactcgttg 1465
to top
>dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033035B15, full
            insert sequence
          Length = 1475

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                        
Query: 273  ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
            |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 1163 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1104

                                               
Query: 333  ccttgtcggccaccagcgtcttgccggactcgttg 367
            | |||| ||| || |||||||||||||||||||||
Sbjct: 1103 cgttgttggcgacgagcgtcttgccggactcgttg 1069
to top
>dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G02, full
           insert sequence
          Length = 1293

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 981 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 922

                                              
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttg 367
           | |||| ||| || |||||||||||||||||||||
Sbjct: 921 cgttgttggcgacgagcgtcttgccggactcgttg 887
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                            
Query: 273      ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
                |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 21353021 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21352962

                                                   
Query: 333      ccttgtcggccaccagcgtcttgccggactcgttg 367
                | |||| ||| || |||||||||||||||||||||
Sbjct: 21352961 cgttgttggcgacgagcgtcttgccggactcgttg 21352927



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                            
Query: 276      agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
                ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 21322567 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21322626

                                         
Query: 336      tgtcggccaccagcgtcttgccgga 360
                ||| ||| || ||||||||||||||
Sbjct: 21322627 tgttggcgacgagcgtcttgccgga 21322651



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                            
Query: 277      gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
                ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 21340318 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21340377

                                                
Query: 337      gtcggccaccagcgtcttgccggactcgttgg 368
                |  ||| || |||  |||||||||||||||||
Sbjct: 21340378 gctggcgacgagctgcttgccggactcgttgg 21340409



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 316      ccagttggccgggatgacct 335
                ||||||||||||||||||||
Sbjct: 21328469 ccagttggccgggatgacct 21328488
to top
>gb|AY111405.1| Zea mays CL5426_1 mRNA sequence
          Length = 528

 Score =  113 bits (57), Expect = 4e-22
 Identities = 81/89 (91%)
 Strand = Plus / Plus

                                                                       
Query: 280 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           |||||||| |||||| |||||| ||||| ||||  ||||||||||||||||||||| || 
Sbjct: 263 gtactggatgatggaacggtagtaggtgttgggaacccagttggccgggatgacctggtt 322

                                        
Query: 340 ggccaccagcgtcttgccggactcgttgg 368
           |||||||||||||||||||||||||||||
Sbjct: 323 ggccaccagcgtcttgccggactcgttgg 351
to top
>gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence
          Length = 832

 Score =  111 bits (56), Expect = 2e-21
 Identities = 83/92 (90%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 303 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 244

                                           
Query: 336 tgtcggccaccagcgtcttgccggactcgttg 367
           ||| ||| || |||||||||||||||||||||
Sbjct: 243 tgttggcgacgagcgtcttgccggactcgttg 212
to top
>emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansin B3 (expB3 gene)
          Length = 1219

 Score =  111 bits (56), Expect = 2e-21
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 269 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 328
           |||| ||||||| |||||||||||||||||||| ||| |||||| ||||| |||||||||
Sbjct: 911 cagcctcagctgaactggacgatggagcggtaggaggcgctgggggcccaattggccggg 852

                                                   
Query: 329 atgaccttgtcggccaccagcgtcttgccggactcgttgg 368
           |||| ||||||||| || |||  |||||||||||||||||
Sbjct: 851 atgatcttgtcggcgacgagctgcttgccggactcgttgg 812



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 43/48 (89%), Gaps = 4/48 (8%)
 Strand = Plus / Minus

                                                            
Query: 109  tattcaagacacacatgca----cgacgacgcctacatgacacccgac 152
            |||| ||||||||||||||    |||||||||||||||||||||||||
Sbjct: 1072 tattgaagacacacatgcaggatcgacgacgcctacatgacacccgac 1025
to top
>gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, complete cds
          Length = 1479

 Score =  111 bits (56), Expect = 2e-21
 Identities = 83/92 (90%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 939 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 880

                                           
Query: 336 tgtcggccaccagcgtcttgccggactcgttg 367
           ||| ||| || |||||||||||||||||||||
Sbjct: 879 tgttggcgacgagcgtcttgccggactcgttg 848
to top
>gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence
          Length = 1044

 Score =  103 bits (52), Expect = 4e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 564 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 505

                                           
Query: 336 tgtcggccaccagcgtcttgccggactcgttg 367
           ||| ||| || ||||||||| |||||||||||
Sbjct: 504 tgttggcgacgagcgtcttggcggactcgttg 473
to top
>gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, partial cds
          Length = 907

 Score =  103 bits (52), Expect = 4e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| |||||||||||||||| |||||  |||||||||||||||||| |
Sbjct: 526 agctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatgacgt 467

                                           
Query: 336 tgtcggccaccagcgtcttgccggactcgttg 367
           |   ||| || |||||||||||||||||||||
Sbjct: 466 tcctggcgacgagcgtcttgccggactcgttg 435
to top
>gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, complete cds
          Length = 1173

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 281 tactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcg 340
           ||||||||||| || |||||| ||||| ||||| |||||||||| |||||||| | ||| 
Sbjct: 867 tactggacgatagaacggtagtaggtgttgggcacccagttggcggggatgacatggtca 808

                                     
Query: 341 gccaccagcgtcttgccggactcgtt 366
           ||||||||||||||||||||||||||
Sbjct: 807 gccaccagcgtcttgccggactcgtt 782
to top
>gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, complete cds
          Length = 1013

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgac 333
           ||||||| ||||||||| ||||||||||  |||| |||||  ||||||||||||||||||
Sbjct: 859 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 800

                                      
Query: 334 cttgtcggccaccagcgtcttgccgga 360
            |||| |||||||||| ||||||||||
Sbjct: 799 attgttggccaccagcttcttgccgga 773
to top
>gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds
          Length = 1056

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgac 333
           ||||||| ||||||||| ||||||||||  |||| |||||  ||||||||||||||||||
Sbjct: 891 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 832

                                      
Query: 334 cttgtcggccaccagcgtcttgccgga 360
            |||| |||||||||| ||||||||||
Sbjct: 831 attgttggccaccagcttcttgccgga 805
to top
>gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, partial cds
          Length = 650

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           |||||| | ||||||||||||| ||||| |||||||||||||||| |||||||||     
Sbjct: 529 gtactgaatgatggagcggtagtaggtgttgggcgcccagttggcagggatgacccgagt 470

                                        
Query: 340 ggccaccagcgtcttgccggactcgttgg 368
           |||||||||| || |||||||||||||||
Sbjct: 469 ggccaccagcttcctgccggactcgttgg 441
to top
>gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, partial cds
          Length = 788

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 282 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
           ||||||||||||||| ||||| | ||  ||||  |||||  ||||| ||||||| ||| |
Sbjct: 644 actggacgatggagctgtagacgttgtcgggctgccagtctgccggaatgacctggtccg 585

                                      
Query: 342 ccaccagcgtcttgccggactcgttgg 368
           |||||||||||||||||||||||||||
Sbjct: 584 ccaccagcgtcttgccggactcgttgg 558
to top
>ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB6
           (OSJNBb0014I11.3), mRNA
          Length = 1240

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 922 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 863

                                    
Query: 336 tgtcggccaccagcgtcttgccgga 360
           ||| ||| || ||||||||||||||
Sbjct: 862 tgttggcgacgagcgtcttgccgga 838
to top
>gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete cds
          Length = 1250

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 915 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 856

                                    
Query: 336 tgtcggccaccagcgtcttgccgga 360
           ||| ||| || ||||||||||||||
Sbjct: 855 tgttggcgacgagcgtcttgccgga 831
to top
>gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 genomic sequence, complete
             sequence
          Length = 135510

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                         
Query: 276   agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
             ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 23056 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 22997

                                      
Query: 336   tgtcggccaccagcgtcttgccgga 360
             ||| ||| || ||||||||||||||
Sbjct: 22996 tgttggcgacgagcgtcttgccgga 22972



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                        
Query: 277  gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
            ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 5305 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 5246

                                            
Query: 337  gtcggccaccagcgtcttgccggactcgttgg 368
            |  ||| || |||  |||||||||||||||||
Sbjct: 5245 gctggcgacgagctgcttgccggactcgttgg 5214



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 316   ccagttggccgggatgacct 335
             ||||||||||||||||||||
Sbjct: 17154 ccagttggccgggatgacct 17135
to top
>dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A09, full
           insert sequence
          Length = 1257

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                    
Query: 336 tgtcggccaccagcgtcttgccgga 360
           ||| ||| || ||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccgga 851
to top
>dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A02, full
           insert sequence
          Length = 1257

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                    
Query: 336 tgtcggccaccagcgtcttgccgga 360
           ||| ||| || ||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccgga 851
to top
>dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061F13, full
           insert sequence
          Length = 1263

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 941 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 882

                                    
Query: 336 tgtcggccaccagcgtcttgccgga 360
           ||| ||| || ||||||||||||||
Sbjct: 881 tgttggcgacgagcgtcttgccgga 857
to top
>dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D06, full
           insert sequence
          Length = 1259

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                    
Query: 336 tgtcggccaccagcgtcttgccgga 360
           ||| ||| || ||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccgga 851
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                          
Query: 282    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                         
Query: 342    ccaccagcgtcttgccggactcgttgg 368
              | |  || |||||||||||||||||||
Sbjct: 169362 cgatgagggtcttgccggactcgttgg 169336



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                          
Query: 280    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                   
Query: 340    ggccaccagcgtcttgccgga 360
               ||||||| ||||||||||||
Sbjct: 157726 tgccaccaacgtcttgccgga 157746
to top
>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
            OSJNBb0080O10, from chromosome 3, complete sequence
          Length = 127917

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                        
Query: 282  actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
            ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 6489 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 6430

                                       
Query: 342  ccaccagcgtcttgccggactcgttgg 368
            | |  || |||||||||||||||||||
Sbjct: 6429 cgatgagggtcttgccggactcgttgg 6403
to top
>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNAb0079B22, from chromosome 3, complete sequence
          Length = 156933

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                          
Query: 282    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 103422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 103363

                                         
Query: 342    ccaccagcgtcttgccggactcgttgg 368
              | |  || |||||||||||||||||||
Sbjct: 103362 cgatgagggtcttgccggactcgttgg 103336



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                         
Query: 280   gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
             ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 91666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 91725

                                  
Query: 340   ggccaccagcgtcttgccgga 360
              ||||||| ||||||||||||
Sbjct: 91726 tgccaccaacgtcttgccgga 91746
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                          
Query: 282    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                         
Query: 342    ccaccagcgtcttgccggactcgttgg 368
              | |  || |||||||||||||||||||
Sbjct: 169362 cgatgagggtcttgccggactcgttgg 169336



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                          
Query: 280    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                   
Query: 340    ggccaccagcgtcttgccgga 360
               ||||||| ||||||||||||
Sbjct: 157726 tgccaccaacgtcttgccgga 157746
to top
>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence
          Length = 162241

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                         
Query: 282   actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
             ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 93244 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 93303

                                        
Query: 342   ccaccagcgtcttgccggactcgttgg 368
             | |  || |||||||||||||||||||
Sbjct: 93304 cgatgagggtcttgccggactcgttgg 93330



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                          
Query: 280    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 105000 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 104941

                                   
Query: 340    ggccaccagcgtcttgccgga 360
               ||||||| ||||||||||||
Sbjct: 104940 tgccaccaacgtcttgccgga 104920
to top
>dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-G02, full
           insert sequence
          Length = 1027

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
           ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 834 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 775

                                      
Query: 342 ccaccagcgtcttgccggactcgttgg 368
           | |  || |||||||||||||||||||
Sbjct: 774 cgatgagggtcttgccggactcgttgg 748
to top
>gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete cds
          Length = 1210

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                        
Query: 282  actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
            ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 1026 actggacgatggagctgtaracggtgttgggctgccagtcggcggggatgacctgatcgg 967

                                       
Query: 342  ccaccagcgtcttgccggactcgttgg 368
            | |  || |||||||||||||||||||
Sbjct: 966  cgatgagggtcttgccggactcgttgg 940
to top
>gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence
          Length = 477

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB3
           (OSJNBb0014I11.1), mRNA
          Length = 904

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 898 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 839

                                           
Query: 337 gtcggccaccagcgtcttgccggactcgttgg 368
           |  ||| || |||  |||||||||||||||||
Sbjct: 838 gctggcgacgagctgcttgccggactcgttgg 807
to top
>gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete cds
          Length = 1319

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 897 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 838

                                           
Query: 337 gtcggccaccagcgtcttgccggactcgttgg 368
           |  ||| || |||  |||||||||||||||||
Sbjct: 837 gctggcgacgagctgcttgccggactcgttgg 806
to top
>dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-F11, full
           insert sequence
          Length = 1031

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 653 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 594

                                           
Query: 337 gtcggccaccagcgtcttgccggactcgttgg 368
           |  ||| || |||  |||||||||||||||||
Sbjct: 593 gctggcgacgagctgcttgccggactcgttgg 562
to top
>dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023140O05, full
           insert sequence
          Length = 1313

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 909 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 850

                                           
Query: 337 gtcggccaccagcgtcttgccggactcgttgg 368
           |  ||| || |||  |||||||||||||||||
Sbjct: 849 gctggcgacgagctgcttgccggactcgttgg 818
to top
>dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-H01, full
           insert sequence
          Length = 1794

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttg 367
           ||||| |||||||||||| |||| ||| || |||||||||||||||||||||
Sbjct: 938 ccagtaggccgggatgacgttgttggcgacgagcgtcttgccggactcgttg 887
to top
>gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, complete cds
          Length = 898

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |  | |||||||||||||||||||||
Sbjct: 810 ccagttggccgggatgacttgtttggccaccagcgtcttgccgga 766
to top
>dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069H18, full
           insert sequence
          Length = 1019

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 889 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 830

                                
Query: 340 ggccaccagcgtcttgccgga 360
            ||||||| ||||||||||||
Sbjct: 829 tgccaccaacgtcttgccgga 809
to top
>emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansin B2 (expB2 gene)
          Length = 1194

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 282 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 332
           ||||||||| ||||||||||  |||| |||||  |||||||||||||||||
Sbjct: 884 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatga 834
to top
>gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, complete cds
          Length = 1142

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 318 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttgg 368
           |||||||||||||||| || | ||||||||||  | |||||||||||||||
Sbjct: 873 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttgg 823
to top
>gb|AY104151.1| Zea mays PCO112411 mRNA sequence
          Length = 1171

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 318 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttgg 368
           |||||||||||||||| || | ||||||||||  | |||||||||||||||
Sbjct: 882 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttgg 832
to top
>gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, partial cds
          Length = 671

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 315 cccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttgg 368
           |||||| ||| ||||||||||  |||||  | ||||||||||||||||||||||
Sbjct: 327 cccagtcggcggggatgacctgttcggcggcgagcgtcttgccggactcgttgg 274
to top
>gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds
          Length = 933

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           ||||||||||| ||| ||||| |||||| |||||| |||||||   |||||||| | |  
Sbjct: 807 gtactggacgaaggaacggtaaaaggtgttgggcgtccagttgagggggatgacgtcggg 748

                                
Query: 340 ggccaccagcgtcttgccgga 360
            ||||||| ||||||||||||
Sbjct: 747 tgccaccaacgtcttgccgga 727
to top
>gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, complete cds
          Length = 1034

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 322 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgt 365
           |||||||||||||| |||||| || |||| | ||||||||||||
Sbjct: 904 ggccgggatgacctggtcggcgacgagcgacctgccggactcgt 861
to top
>emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 protein precursor
           (expb11 gene), cultivar Wyuna, from endosperm tissue
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 326 gggatgaccttgtcggccaccagcgtcttgccggactcgttgg 368
           ||||||||||  ||||| || || |||||||||||||||||||
Sbjct: 773 gggatgacctgttcggcgacaagtgtcttgccggactcgttgg 731
to top
>dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, partial cds
          Length = 3511

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 240 catatgattccaaatgatgatg 261
           ||||||||||||||||||||||
Sbjct: 108 catatgattccaaatgatgatg 129
to top
>gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds
          Length = 1078

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccgga 360
           ||||||||||| |||| |||||| |||||||| |||||
Sbjct: 794 gccgggatgacattgttggccacaagcgtcttcccgga 757
to top
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 339     cggccaccagcgtcttgccgg 359
               |||||||||||||||||||||
Sbjct: 1260020 cggccaccagcgtcttgccgg 1260040
to top
>gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete sequence
          Length = 398525

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 253    atgatgatgagttcagcagcttcag 277
              ||||||||||||| |||||||||||
Sbjct: 345505 atgatgatgagttaagcagcttcag 345481
to top
>emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome; segment 4/13
          Length = 349306

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 339    cggccaccagcgtcttgccgg 359
              |||||||||||||||||||||
Sbjct: 226686 cggccaccagcgtcttgccgg 226706
to top
>emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 4/14
          Length = 327650

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 339    cggccaccagcgtcttgccgg 359
              |||||||||||||||||||||
Sbjct: 274844 cggccaccagcgtcttgccgg 274864
to top
>gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complete sequence
          Length = 194374

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 244    tgattccaaatgatgatgagt 264
              |||||||||||||||||||||
Sbjct: 177950 tgattccaaatgatgatgagt 177930
to top
>gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, complete cds
          Length = 939

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccgg 359
           ||||||||| | |||| ||||||||||||||| ||||
Sbjct: 811 gccgggatggcattgttggccaccagcgtctttccgg 775
to top
>gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds
          Length = 1132

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccgg 359
           ||||||||| | |||| ||||||||||||||| ||||
Sbjct: 786 gccgggatggcattgttggccaccagcgtctttccgg 750
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 340     ggccaccagcgtcttgccgg 359
               ||||||||||||||||||||
Sbjct: 2016483 ggccaccagcgtcttgccgg 2016464
to top
>ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB2
           (OSJNBb0014I11.2), mRNA
          Length = 1262

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccagttggccgggatgacct 335
           ||||||||||||||||||||
Sbjct: 813 ccagttggccgggatgacct 794
to top
>gb|AY172516.1| Rhizobium etli transcription repair coupling factor (mfd) gene,
            partial cds; recombination and repair protein (recG)
            gene, complete cds; and unknown gene
          Length = 6176

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  gccaccagcgtcttgccgga 360
            ||||||||||||||||||||
Sbjct: 4669 gccaccagcgtcttgccgga 4650
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 341     gccaccagcgtcttgccgga 360
               ||||||||||||||||||||
Sbjct: 2190610 gccaccagcgtcttgccgga 2190629
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 302     aaggtgctgggcgcccagttggcc 325
               |||||||||| |||||||||||||
Sbjct: 2061004 aaggtgctggtcgcccagttggcc 2060981
to top
>gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, complete sequence
          Length = 177317

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      gcacacacaaacagtaataa 22
              ||||||||||||||||||||
Sbjct: 120092 gcacacacaaacagtaataa 120073
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 337     gtcggccaccagcgtcttgc 356
               ||||||||||||||||||||
Sbjct: 4141074 gtcggccaccagcgtcttgc 4141055
to top
>gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, complete cds
          Length = 999

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccagttggccgggatgacct 335
           ||||||||||||||||||||
Sbjct: 813 ccagttggccgggatgacct 794
to top
>dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-F04, full
           insert sequence
          Length = 1043

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccagttggccgggatgacct 335
           ||||||||||||||||||||
Sbjct: 812 ccagttggccgggatgacct 793
to top
>emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in linkage group 4, complete
              sequence
          Length = 172167

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 240    catatgattccaaatgatgatgagttca 267
              |||||||||| ||||| |||||||||||
Sbjct: 166340 catatgattctaaatggtgatgagttca 166367
to top
>dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C01, full
           insert sequence
          Length = 1259

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccagttggccgggatgacct 335
           ||||||||||||||||||||
Sbjct: 810 ccagttggccgggatgacct 791
to top
>dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F11, full
           insert sequence
          Length = 1026

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccagttggccgggatgacct 335
           ||||||||||||||||||||
Sbjct: 803 ccagttggccgggatgacct 784
to top
>gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, complete sequence
          Length = 182865

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    gcacacacaaacagtaataa 22
            ||||||||||||||||||||
Sbjct: 7061 gcacacacaaacagtaataa 7080
to top
>gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 307    gctgggcgcccagttggccgggat 330
              ||||||||||||||| ||||||||
Sbjct: 594398 gctgggcgcccagtttgccgggat 594375
to top
>gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type 1 subunit gene,
           complete cds
          Length = 1850

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 588 ggccgggatgaccttgtcgg 569


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,135,234
Number of Sequences: 3902068
Number of extensions: 3135234
Number of successful extensions: 58709
Number of sequences better than 10.0: 98
Number of HSP's better than 10.0 without gapping: 98
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58234
Number of HSP's gapped (non-prelim): 449
length of query: 368
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 346
effective length of database: 17,147,199,772
effective search space: 5932931121112
effective search space used: 5932931121112
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top