ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart53d03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, com... 228 1e-56
2gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds 206 4e-50
3gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds 204 2e-49
4gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds 133 5e-28
5gb|AY111405.1| Zea mays CL5426_1 mRNA sequence 121 2e-24
6emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansi... 119 7e-24
7ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-exp... 117 3e-23
8gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete... 117 3e-23
9gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 geno... 117 3e-23
10dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 117 3e-23
11dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
12dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
13dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
14dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
15dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
16gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 117 3e-23
17gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence 111 2e-21
18gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, co... 111 2e-21
19gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence 103 4e-19
20gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, pa... 103 4e-19
21gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, com... 101 2e-18
22gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds 101 2e-18
23gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, co... 100 6e-18
24gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, pa... 88 2e-14
25gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, pa... 84 4e-13
26gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 78 2e-11
27gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare str... 78 2e-11
28gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare str... 78 2e-11
29dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 78 2e-11
30gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence 78 2e-11
31dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 2e-11
32ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-exp... 74 4e-10
33gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete... 74 4e-10
34gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete... 74 4e-10
35gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 gen... 74 4e-10
36dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
37dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
38dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
39dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
40ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-exp... 72 1e-09
41gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete... 72 1e-09
42dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 1e-09
43dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 1e-09
44gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence 66 9e-08
45gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 ge... 66 9e-08
46gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 ge... 66 9e-08
47gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 ge... 66 9e-08
48gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 ge... 66 9e-08
49gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 ge... 66 9e-08
50gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 ge... 66 9e-08
51gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 ge... 66 9e-08
52gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 ge... 66 9e-08
53gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 ge... 66 9e-08
54gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 ge... 66 9e-08
55gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 ge... 66 9e-08
56gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 ge... 66 9e-08
57gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 ge... 66 9e-08
58gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 ge... 66 9e-08
59gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 ge... 66 9e-08
60gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 ge... 66 9e-08
61gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 geno... 66 9e-08
62dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
63emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansi... 62 1e-06
64gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, co... 62 1e-06
65gb|AY104151.1| Zea mays PCO112411 mRNA sequence 62 1e-06
66gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, com... 58 2e-05
67dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
68gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, parti... 56 9e-05
69emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 prote... 54 3e-04
70gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, com... 52 0.001
71gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds 52 0.001
72gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds 50 0.005
73gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, com... 44 0.33
74dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, parti... 44 0.33
75gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds 44 0.33
76gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 42 1.3
77gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete se... 42 1.3
78emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome... 42 1.3
79emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 42 1.3
80gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complet... 42 1.3
81gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 5.1
82ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-exp... 40 5.1
83gb|AY172516.1| Rhizobium etli transcription repair coupling fact... 40 5.1
84gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 5.1
85gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 5.1
86gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, comp... 40 5.1
87gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 5.1
88gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, co... 40 5.1
89dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.1
90emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in ... 40 5.1
91dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.1
92dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.1
93gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, co... 40 5.1
94gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 ... 40 5.1
95gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-... 40 5.1
96gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-... 40 5.1
97gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 5.1
98gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type... 40 5.1 
>gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, complete cds
          Length = 897

 Score =  228 bits (115), Expect = 1e-56
 Identities = 152/164 (92%), Gaps = 9/164 (5%)
 Strand = Plus / Minus

                                                                       
Query: 226 gataccaaatctagccaatgtatgcatatgattccaaatgatga-------tgagttcag 278
           ||||||||||| |||||||| ||||||  |||||||||||||||       | |||||||
Sbjct: 895 gataccaaatcaagccaatgcatgcat--gattccaaatgatgagttcggttcagttcag 838

                                                                       
Query: 279 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 338
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 837 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 778

                                                       
Query: 339 atgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 777 atgaccttgtcggccaccagcgtcttgccggactcgttggtgat 734
to top
>gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds
          Length = 810

 Score =  206 bits (104), Expect = 4e-50
 Identities = 104/104 (100%)
 Strand = Plus / Minus

                                                                       
Query: 279 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 338
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 810 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 751

                                                       
Query: 339 atgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 750 atgaccttgtcggccaccagcgtcttgccggactcgttggtgat 707
to top
>gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds
          Length = 834

 Score =  204 bits (103), Expect = 2e-49
 Identities = 109/111 (98%)
 Strand = Plus / Minus

                                                                       
Query: 272 agttcagcagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagtt 331
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 823 agttcagcagcttcagctgtactggacgatggaacggtagaaggtgctgggcgcccagtt 764

                                                              
Query: 332 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           ||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 763 ggccgggatgaccttgtcggccaccagcgacttgccggactcgttggtgat 713
to top
>gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds
          Length = 948

 Score =  133 bits (67), Expect = 5e-28
 Identities = 88/95 (92%)
 Strand = Plus / Minus

                                                                       
Query: 283 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
           |||||||||||||||||| |||||||||||||||| |||||  |||||||||||||||||
Sbjct: 882 ttcagctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatga 823

                                              
Query: 343 ccttgtcggccaccagcgtcttgccggactcgttg 377
           |||||| ||| || |||||||||||||||||||||
Sbjct: 822 ccttgttggcgacgagcgtcttgccggactcgttg 788
to top
>gb|AY111405.1| Zea mays CL5426_1 mRNA sequence
          Length = 528

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 290 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 349
           |||||||| |||||| |||||| ||||| ||||  ||||||||||||||||||||| || 
Sbjct: 263 gtactggatgatggaacggtagtaggtgttgggaacccagttggccgggatgacctggtt 322

                                            
Query: 350 ggccaccagcgtcttgccggactcgttggtgat 382
           |||||||||||||||||||||||||||||||||
Sbjct: 323 ggccaccagcgtcttgccggactcgttggtgat 355
to top
>emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansin B3 (expB3 gene)
          Length = 1219

 Score =  119 bits (60), Expect = 7e-24
 Identities = 93/104 (89%)
 Strand = Plus / Minus

                                                                       
Query: 279 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 338
           |||| ||||||| |||||||||||||||||||| ||| |||||| ||||| |||||||||
Sbjct: 911 cagcctcagctgaactggacgatggagcggtaggaggcgctgggggcccaattggccggg 852

                                                       
Query: 339 atgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           |||| ||||||||| || |||  |||||||||||||||||||||
Sbjct: 851 atgatcttgtcggcgacgagctgcttgccggactcgttggtgat 808



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 43/48 (89%), Gaps = 4/48 (8%)
 Strand = Plus / Minus

                                                            
Query: 119  tattcaagacacacatgca----cgacgacgcctacatgacacccgac 162
            |||| ||||||||||||||    |||||||||||||||||||||||||
Sbjct: 1072 tattgaagacacacatgcaggatcgacgacgcctacatgacacccgac 1025



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 15   acacacaaacagtaataacttatgat 40
            |||||||||| |||||||||||||||
Sbjct: 1186 acacacaaactgtaataacttatgat 1161
to top
>ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB4
           (OSJNBa0010C11.2), mRNA
          Length = 1340

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 283 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 969 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 910

                                              
Query: 343 ccttgtcggccaccagcgtcttgccggactcgttg 377
           | |||| ||| || |||||||||||||||||||||
Sbjct: 909 cgttgttggcgacgagcgtcttgccggactcgttg 875
to top
>gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete cds
          Length = 1249

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 283 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 925 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 866

                                              
Query: 343 ccttgtcggccaccagcgtcttgccggactcgttg 377
           | |||| ||| || |||||||||||||||||||||
Sbjct: 865 cgttgttggcgacgagcgtcttgccggactcgttg 831
to top
>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete
             sequence
          Length = 147117

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                         
Query: 283   ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
             |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 16771 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 16712

                                                
Query: 343   ccttgtcggccaccagcgtcttgccggactcgttg 377
             | |||| ||| || |||||||||||||||||||||
Sbjct: 16711 cgttgttggcgacgagcgtcttgccggactcgttg 16677



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                        
Query: 287  gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 346
            ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 4068 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 4127

                                                
Query: 347  gtcggccaccagcgtcttgccggactcgttggtgat 382
            |  ||| || |||  |||||||||||||||||||||
Sbjct: 4128 gctggcgacgagctgcttgccggactcgttggtgat 4163
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                            
Query: 283      ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
                |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 21341758 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21341699

                                                   
Query: 343      ccttgtcggccaccagcgtcttgccggactcgttg 377
                | |||| ||| || |||||||||||||||||||||
Sbjct: 21341698 cgttgttggcgacgagcgtcttgccggactcgttg 21341664



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                            
Query: 286      agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
                ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 21311303 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21311362

                                         
Query: 346      tgtcggccaccagcgtcttgccgga 370
                ||| ||| || ||||||||||||||
Sbjct: 21311363 tgttggcgacgagcgtcttgccgga 21311387



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                            
Query: 287      gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 346
                ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 21329054 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21329113

                                                    
Query: 347      gtcggccaccagcgtcttgccggactcgttggtgat 382
                |  ||| || |||  |||||||||||||||||||||
Sbjct: 21329114 gctggcgacgagctgcttgccggactcgttggtgat 21329149



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 326      ccagttggccgggatgacct 345
                ||||||||||||||||||||
Sbjct: 21317205 ccagttggccgggatgacct 21317224
to top
>dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-F12, full
           insert sequence
          Length = 1290

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 283 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 982 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 923

                                              
Query: 343 ccttgtcggccaccagcgtcttgccggactcgttg 377
           | |||| ||| || |||||||||||||||||||||
Sbjct: 922 cgttgttggcgacgagcgtcttgccggactcgttg 888
to top
>dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D11, full
           insert sequence
          Length = 1266

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 283 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 975 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 916

                                              
Query: 343 ccttgtcggccaccagcgtcttgccggactcgttg 377
           | |||| ||| || |||||||||||||||||||||
Sbjct: 915 cgttgttggcgacgagcgtcttgccggactcgttg 881
to top
>dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033066K12, full
            insert sequence
          Length = 1883

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                        
Query: 283  ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
            |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 1559 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1500

                                               
Query: 343  ccttgtcggccaccagcgtcttgccggactcgttg 377
            | |||| ||| || |||||||||||||||||||||
Sbjct: 1499 cgttgttggcgacgagcgtcttgccggactcgttg 1465
to top
>dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033035B15, full
            insert sequence
          Length = 1475

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                        
Query: 283  ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
            |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 1163 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1104

                                               
Query: 343  ccttgtcggccaccagcgtcttgccggactcgttg 377
            | |||| ||| || |||||||||||||||||||||
Sbjct: 1103 cgttgttggcgacgagcgtcttgccggactcgttg 1069
to top
>dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G02, full
           insert sequence
          Length = 1293

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 283 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 981 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 922

                                              
Query: 343 ccttgtcggccaccagcgtcttgccggactcgttg 377
           | |||| ||| || |||||||||||||||||||||
Sbjct: 921 cgttgttggcgacgagcgtcttgccggactcgttg 887
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                            
Query: 283      ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 342
                |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 21353021 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21352962

                                                   
Query: 343      ccttgtcggccaccagcgtcttgccggactcgttg 377
                | |||| ||| || |||||||||||||||||||||
Sbjct: 21352961 cgttgttggcgacgagcgtcttgccggactcgttg 21352927



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                            
Query: 286      agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
                ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 21322567 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21322626

                                         
Query: 346      tgtcggccaccagcgtcttgccgga 370
                ||| ||| || ||||||||||||||
Sbjct: 21322627 tgttggcgacgagcgtcttgccgga 21322651



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                            
Query: 287      gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 346
                ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 21340318 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21340377

                                                    
Query: 347      gtcggccaccagcgtcttgccggactcgttggtgat 382
                |  ||| || |||  |||||||||||||||||||||
Sbjct: 21340378 gctggcgacgagctgcttgccggactcgttggtgat 21340413



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 326      ccagttggccgggatgacct 345
                ||||||||||||||||||||
Sbjct: 21328469 ccagttggccgggatgacct 21328488
to top
>gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence
          Length = 832

 Score =  111 bits (56), Expect = 2e-21
 Identities = 83/92 (90%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 303 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 244

                                           
Query: 346 tgtcggccaccagcgtcttgccggactcgttg 377
           ||| ||| || |||||||||||||||||||||
Sbjct: 243 tgttggcgacgagcgtcttgccggactcgttg 212
to top
>gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, complete cds
          Length = 1479

 Score =  111 bits (56), Expect = 2e-21
 Identities = 83/92 (90%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 939 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 880

                                           
Query: 346 tgtcggccaccagcgtcttgccggactcgttg 377
           ||| ||| || |||||||||||||||||||||
Sbjct: 879 tgttggcgacgagcgtcttgccggactcgttg 848
to top
>gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence
          Length = 1044

 Score =  103 bits (52), Expect = 4e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 564 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 505

                                           
Query: 346 tgtcggccaccagcgtcttgccggactcgttg 377
           ||| ||| || ||||||||| |||||||||||
Sbjct: 504 tgttggcgacgagcgtcttggcggactcgttg 473
to top
>gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, partial cds
          Length = 907

 Score =  103 bits (52), Expect = 4e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||||||||||||| |||||||||||||||| |||||  |||||||||||||||||| |
Sbjct: 526 agctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatgacgt 467

                                           
Query: 346 tgtcggccaccagcgtcttgccggactcgttg 377
           |   ||| || |||||||||||||||||||||
Sbjct: 466 tcctggcgacgagcgtcttgccggactcgttg 435
to top
>gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, complete cds
          Length = 1013

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 284 tcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgac 343
           ||||||| ||||||||| ||||||||||  |||| |||||  ||||||||||||||||||
Sbjct: 859 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 800

                                                  
Query: 344 cttgtcggccaccagcgtcttgccggactcgttggtgat 382
            |||| |||||||||| |||||||||| ||| |||||||
Sbjct: 799 attgttggccaccagcttcttgccggagtcgctggtgat 761
to top
>gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds
          Length = 1056

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 284 tcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgac 343
           ||||||| ||||||||| ||||||||||  |||| |||||  ||||||||||||||||||
Sbjct: 891 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 832

                                                  
Query: 344 cttgtcggccaccagcgtcttgccggactcgttggtgat 382
            |||| |||||||||| |||||||||| ||| |||||||
Sbjct: 831 attgttggccaccagcttcttgccggagtcgctggtgat 793
to top
>gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, complete cds
          Length = 1173

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 tactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcg 350
           ||||||||||| || |||||| ||||| ||||| |||||||||| |||||||| | ||| 
Sbjct: 867 tactggacgatagaacggtagtaggtgttgggcacccagttggcggggatgacatggtca 808

                                     
Query: 351 gccaccagcgtcttgccggactcgtt 376
           ||||||||||||||||||||||||||
Sbjct: 807 gccaccagcgtcttgccggactcgtt 782
to top
>gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, partial cds
          Length = 650

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 290 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 349
           |||||| | ||||||||||||| ||||| |||||||||||||||| |||||||||     
Sbjct: 529 gtactgaatgatggagcggtagtaggtgttgggcgcccagttggcagggatgacccgagt 470

                                           
Query: 350 ggccaccagcgtcttgccggactcgttggtga 381
           |||||||||| || ||||||||||||||||||
Sbjct: 469 ggccaccagcttcctgccggactcgttggtga 438
to top
>gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, partial cds
          Length = 788

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 292 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 351
           ||||||||||||||| ||||| | ||  ||||  |||||  ||||| ||||||| ||| |
Sbjct: 644 actggacgatggagctgtagacgttgtcgggctgccagtctgccggaatgacctggtccg 585

                                         
Query: 352 ccaccagcgtcttgccggactcgttggtga 381
           ||||||||||||||||||||||||||||||
Sbjct: 584 ccaccagcgtcttgccggactcgttggtga 555
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                          
Query: 292    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 351
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                             
Query: 352    ccaccagcgtcttgccggactcgttggtgat 382
              | |  || |||||||||||||||||||||||
Sbjct: 169362 cgatgagggtcttgccggactcgttggtgat 169332



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                          
Query: 290    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 349
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                   
Query: 350    ggccaccagcgtcttgccgga 370
               ||||||| ||||||||||||
Sbjct: 157726 tgccaccaacgtcttgccgga 157746
to top
>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
            OSJNBb0080O10, from chromosome 3, complete sequence
          Length = 127917

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                        
Query: 292  actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 351
            ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 6489 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 6430

                                           
Query: 352  ccaccagcgtcttgccggactcgttggtgat 382
            | |  || |||||||||||||||||||||||
Sbjct: 6429 cgatgagggtcttgccggactcgttggtgat 6399
to top
>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNAb0079B22, from chromosome 3, complete sequence
          Length = 156933

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                          
Query: 292    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 351
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 103422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 103363

                                             
Query: 352    ccaccagcgtcttgccggactcgttggtgat 382
              | |  || |||||||||||||||||||||||
Sbjct: 103362 cgatgagggtcttgccggactcgttggtgat 103332



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                         
Query: 290   gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 349
             ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 91666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 91725

                                  
Query: 350   ggccaccagcgtcttgccgga 370
              ||||||| ||||||||||||
Sbjct: 91726 tgccaccaacgtcttgccgga 91746
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                          
Query: 292    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 351
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                             
Query: 352    ccaccagcgtcttgccggactcgttggtgat 382
              | |  || |||||||||||||||||||||||
Sbjct: 169362 cgatgagggtcttgccggactcgttggtgat 169332



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                          
Query: 290    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 349
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                   
Query: 350    ggccaccagcgtcttgccgga 370
               ||||||| ||||||||||||
Sbjct: 157726 tgccaccaacgtcttgccgga 157746
to top
>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence
          Length = 162241

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 292   actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 351
             ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 93244 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 93303

                                            
Query: 352   ccaccagcgtcttgccggactcgttggtgat 382
             | |  || |||||||||||||||||||||||
Sbjct: 93304 cgatgagggtcttgccggactcgttggtgat 93334



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                          
Query: 290    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 349
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 105000 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 104941

                                   
Query: 350    ggccaccagcgtcttgccgga 370
               ||||||| ||||||||||||
Sbjct: 104940 tgccaccaacgtcttgccgga 104920
to top
>dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-G02, full
           insert sequence
          Length = 1027

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 292 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 351
           ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 834 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 775

                                          
Query: 352 ccaccagcgtcttgccggactcgttggtgat 382
           | |  || |||||||||||||||||||||||
Sbjct: 774 cgatgagggtcttgccggactcgttggtgat 744
to top
>ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB6
           (OSJNBb0014I11.3), mRNA
          Length = 1240

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 922 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 863

                                    
Query: 346 tgtcggccaccagcgtcttgccgga 370
           ||| ||| || ||||||||||||||
Sbjct: 862 tgttggcgacgagcgtcttgccgga 838
to top
>gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete cds
          Length = 1210

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                        
Query: 292  actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 351
            ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 1026 actggacgatggagctgtaracggtgttgggctgccagtcggcggggatgacctgatcgg 967

                                           
Query: 352  ccaccagcgtcttgccggactcgttggtgat 382
            | |  || |||||||||||||||||||||||
Sbjct: 966  cgatgagggtcttgccggactcgttggtgat 936
to top
>gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete cds
          Length = 1250

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 915 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 856

                                    
Query: 346 tgtcggccaccagcgtcttgccgga 370
           ||| ||| || ||||||||||||||
Sbjct: 855 tgttggcgacgagcgtcttgccgga 831
to top
>gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 genomic sequence, complete
             sequence
          Length = 135510

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                         
Query: 286   agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
             ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 23056 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 22997

                                      
Query: 346   tgtcggccaccagcgtcttgccgga 370
             ||| ||| || ||||||||||||||
Sbjct: 22996 tgttggcgacgagcgtcttgccgga 22972



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                        
Query: 287  gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 346
            ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 5305 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 5246

                                                
Query: 347  gtcggccaccagcgtcttgccggactcgttggtgat 382
            |  ||| || |||  |||||||||||||||||||||
Sbjct: 5245 gctggcgacgagctgcttgccggactcgttggtgat 5210



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 326   ccagttggccgggatgacct 345
             ||||||||||||||||||||
Sbjct: 17154 ccagttggccgggatgacct 17135
to top
>dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A09, full
           insert sequence
          Length = 1257

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                    
Query: 346 tgtcggccaccagcgtcttgccgga 370
           ||| ||| || ||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccgga 851
to top
>dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A02, full
           insert sequence
          Length = 1257

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                    
Query: 346 tgtcggccaccagcgtcttgccgga 370
           ||| ||| || ||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccgga 851
to top
>dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061F13, full
           insert sequence
          Length = 1263

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 941 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 882

                                    
Query: 346 tgtcggccaccagcgtcttgccgga 370
           ||| ||| || ||||||||||||||
Sbjct: 881 tgttggcgacgagcgtcttgccgga 857
to top
>dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D06, full
           insert sequence
          Length = 1259

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 286 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 345
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                    
Query: 346 tgtcggccaccagcgtcttgccgga 370
           ||| ||| || ||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccgga 851
to top
>ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB3
           (OSJNBb0014I11.1), mRNA
          Length = 904

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                       
Query: 287 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 346
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 898 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 839

                                               
Query: 347 gtcggccaccagcgtcttgccggactcgttggtgat 382
           |  ||| || |||  |||||||||||||||||||||
Sbjct: 838 gctggcgacgagctgcttgccggactcgttggtgat 803
to top
>gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete cds
          Length = 1319

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                       
Query: 287 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 346
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 897 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 838

                                               
Query: 347 gtcggccaccagcgtcttgccggactcgttggtgat 382
           |  ||| || |||  |||||||||||||||||||||
Sbjct: 837 gctggcgacgagctgcttgccggactcgttggtgat 802
to top
>dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-F11, full
           insert sequence
          Length = 1031

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                       
Query: 287 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 346
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 653 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 594

                                               
Query: 347 gtcggccaccagcgtcttgccggactcgttggtgat 382
           |  ||| || |||  |||||||||||||||||||||
Sbjct: 593 gctggcgacgagctgcttgccggactcgttggtgat 558
to top
>dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023140O05, full
           insert sequence
          Length = 1313

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                       
Query: 287 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 346
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 909 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 850

                                               
Query: 347 gtcggccaccagcgtcttgccggactcgttggtgat 382
           |  ||| || |||  |||||||||||||||||||||
Sbjct: 849 gctggcgacgagctgcttgccggactcgttggtgat 814
to top
>gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence
          Length = 477

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-H01, full
           insert sequence
          Length = 1794

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttg 377
           ||||| |||||||||||| |||| ||| || |||||||||||||||||||||
Sbjct: 938 ccagtaggccgggatgacgttgttggcgacgagcgtcttgccggactcgttg 887
to top
>emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansin B2 (expB2 gene)
          Length = 1194

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                       
Query: 292 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 351
           ||||||||| ||||||||||  |||| |||||  |||||||||||||||||  |||| ||
Sbjct: 884 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgatgttgttgg 825

                                          
Query: 352 ccaccagcgtcttgccggactcgttggtgat 382
           | || |||  ||||||||| ||| |||||||
Sbjct: 824 cgacgagctgcttgccggagtcgctggtgat 794
to top
>gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, complete cds
          Length = 1142

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 328 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           |||||||||||||||| || | ||||||||||  | |||||||||||||||||||
Sbjct: 873 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgat 819
to top
>gb|AY104151.1| Zea mays PCO112411 mRNA sequence
          Length = 1171

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 328 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           |||||||||||||||| || | ||||||||||  | |||||||||||||||||||
Sbjct: 882 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgat 828
to top
>gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, complete cds
          Length = 898

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 326 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 370
           |||||||||||||||||| |  | |||||||||||||||||||||
Sbjct: 810 ccagttggccgggatgacttgtttggccaccagcgtcttgccgga 766
to top
>dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069H18, full
           insert sequence
          Length = 1019

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 290 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 349
           ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 889 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 830

                                
Query: 350 ggccaccagcgtcttgccgga 370
            ||||||| ||||||||||||
Sbjct: 829 tgccaccaacgtcttgccgga 809
to top
>gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, partial cds
          Length = 671

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 cccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           |||||| ||| ||||||||||  |||||  | ||||||||||||||||||||||| ||
Sbjct: 327 cccagtcggcggggatgacctgttcggcggcgagcgtcttgccggactcgttggtkat 270
to top
>emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 protein precursor
           (expb11 gene), cultivar Wyuna, from endosperm tissue
          Length = 1032

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 336 gggatgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           ||||||||||  ||||| || || |||||||||||||||||||||||
Sbjct: 773 gggatgacctgttcggcgacaagtgtcttgccggactcgttggtgat 727
to top
>gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, complete cds
          Length = 1034

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 332 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtga 381
           |||||||||||||| |||||| || |||| | |||||||||||| |||||
Sbjct: 904 ggccgggatgacctggtcggcgacgagcgacctgccggactcgtcggtga 855
to top
>gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds
          Length = 1078

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 333 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           ||||||||||| |||| |||||| |||||||| ||||| ||| |||||||
Sbjct: 794 gccgggatgacattgttggccacaagcgtcttcccggagtcgctggtgat 745
to top
>gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds
          Length = 933

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 290 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 349
           ||||||||||| ||| ||||| |||||| |||||| |||||||   |||||||| | |  
Sbjct: 807 gtactggacgaaggaacggtaaaaggtgttgggcgtccagttgagggggatgacgtcggg 748

                                
Query: 350 ggccaccagcgtcttgccgga 370
            ||||||| ||||||||||||
Sbjct: 747 tgccaccaacgtcttgccgga 727
to top
>gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, complete cds
          Length = 939

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 333 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           ||||||||| | |||| ||||||||||||||| ||||  ||| |||||||
Sbjct: 811 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgat 762
to top
>dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, partial cds
          Length = 3511

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 250 catatgattccaaatgatgatg 271
           ||||||||||||||||||||||
Sbjct: 108 catatgattccaaatgatgatg 129
to top
>gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds
          Length = 1132

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 333 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgat 382
           ||||||||| | |||| ||||||||||||||| ||||  ||| |||||||
Sbjct: 786 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgat 737
to top
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 349     cggccaccagcgtcttgccgg 369
               |||||||||||||||||||||
Sbjct: 1260020 cggccaccagcgtcttgccgg 1260040
to top
>gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete sequence
          Length = 398525

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 263    atgatgatgagttcagcagcttcag 287
              ||||||||||||| |||||||||||
Sbjct: 345505 atgatgatgagttaagcagcttcag 345481
to top
>emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome; segment 4/13
          Length = 349306

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 349    cggccaccagcgtcttgccgg 369
              |||||||||||||||||||||
Sbjct: 226686 cggccaccagcgtcttgccgg 226706
to top
>emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 4/14
          Length = 327650

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 349    cggccaccagcgtcttgccgg 369
              |||||||||||||||||||||
Sbjct: 274844 cggccaccagcgtcttgccgg 274864
to top
>gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complete sequence
          Length = 194374

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 254    tgattccaaatgatgatgagt 274
              |||||||||||||||||||||
Sbjct: 177950 tgattccaaatgatgatgagt 177930
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 350     ggccaccagcgtcttgccgg 369
               ||||||||||||||||||||
Sbjct: 2016483 ggccaccagcgtcttgccgg 2016464
to top
>ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB2
           (OSJNBb0014I11.2), mRNA
          Length = 1262

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 326 ccagttggccgggatgacct 345
           ||||||||||||||||||||
Sbjct: 813 ccagttggccgggatgacct 794
to top
>gb|AY172516.1| Rhizobium etli transcription repair coupling factor (mfd) gene,
            partial cds; recombination and repair protein (recG)
            gene, complete cds; and unknown gene
          Length = 6176

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 351  gccaccagcgtcttgccgga 370
            ||||||||||||||||||||
Sbjct: 4669 gccaccagcgtcttgccgga 4650
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 351     gccaccagcgtcttgccgga 370
               ||||||||||||||||||||
Sbjct: 2190610 gccaccagcgtcttgccgga 2190629
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 312     aaggtgctgggcgcccagttggcc 335
               |||||||||| |||||||||||||
Sbjct: 2061004 aaggtgctggtcgcccagttggcc 2060981
to top
>gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, complete sequence
          Length = 177317

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     gcacacacaaacagtaataa 32
              ||||||||||||||||||||
Sbjct: 120092 gcacacacaaacagtaataa 120073
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 347     gtcggccaccagcgtcttgc 366
               ||||||||||||||||||||
Sbjct: 4141074 gtcggccaccagcgtcttgc 4141055
to top
>gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, complete cds
          Length = 999

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 326 ccagttggccgggatgacct 345
           ||||||||||||||||||||
Sbjct: 813 ccagttggccgggatgacct 794
to top
>dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-F04, full
           insert sequence
          Length = 1043

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 326 ccagttggccgggatgacct 345
           ||||||||||||||||||||
Sbjct: 812 ccagttggccgggatgacct 793
to top
>emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in linkage group 4, complete
              sequence
          Length = 172167

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 250    catatgattccaaatgatgatgagttca 277
              |||||||||| ||||| |||||||||||
Sbjct: 166340 catatgattctaaatggtgatgagttca 166367
to top
>dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C01, full
           insert sequence
          Length = 1259

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 326 ccagttggccgggatgacct 345
           ||||||||||||||||||||
Sbjct: 810 ccagttggccgggatgacct 791
to top
>dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F11, full
           insert sequence
          Length = 1026

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 326 ccagttggccgggatgacct 345
           ||||||||||||||||||||
Sbjct: 803 ccagttggccgggatgacct 784
to top
>gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, complete sequence
          Length = 182865

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 13   gcacacacaaacagtaataa 32
            ||||||||||||||||||||
Sbjct: 7061 gcacacacaaacagtaataa 7080
to top
>gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 ggccgggatgaccttgtcgg 351
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 ggccgggatgaccttgtcgg 351
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 ggccgggatgaccttgtcgg 351
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 317    gctgggcgcccagttggccgggat 340
              ||||||||||||||| ||||||||
Sbjct: 594398 gctgggcgcccagtttgccgggat 594375
to top
>gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type 1 subunit gene,
           complete cds
          Length = 1850

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 ggccgggatgaccttgtcgg 351
           ||||||||||||||||||||
Sbjct: 588 ggccgggatgaccttgtcgg 569


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,170,968
Number of Sequences: 3902068
Number of extensions: 3170968
Number of successful extensions: 60319
Number of sequences better than 10.0: 98
Number of HSP's better than 10.0 without gapping: 98
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59837
Number of HSP's gapped (non-prelim): 456
length of query: 382
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 360
effective length of database: 17,147,199,772
effective search space: 6172991917920
effective search space used: 6172991917920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top