ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart53d01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC089149.1| Xenopus laevis cDNA clone MGC:85067 IMAGE:6327400... 42 0.23
2gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete... 40 0.92
3gb|AC102792.7| Mus musculus chromosome 7, clone RP23-370I17, com... 40 0.92
4gb|AE003704.3| Drosophila melanogaster chromosome 3R, section 42... 40 0.92
5gb|AC009395.7| Drosophila melanogaster clone BACR01D01, complete... 38 3.6
6gb|AC009736.10| Drosophila melanogaster clone BACR10A04, complet... 38 3.6
7emb|Z83001.1|HSG0453 Human DNA sequence from clone XX-G0453 on c... 38 3.6
8emb|AL590128.11| Human DNA sequence from clone RP11-312B8 on chr... 38 3.6
9emb|AL355309.27| Human DNA sequence from clone RP11-332E4 on chr... 38 3.6
10emb|AL035459.6|HS81G23 Human DNA sequence from clone RP1-81G23 o... 38 3.6
11emb|AL731722.19| Mouse DNA sequence from clone RP23-57M16 on chr... 38 3.6
12gb|AC113192.3| Homo sapiens chromosome 11, clone RP11-646J21, co... 38 3.6
13gb|AC132216.7| Homo sapiens chromosome 11, clone RP13-786C16, co... 38 3.6
14gb|AE003722.4| Drosophila melanogaster chromosome 3R, section 60... 38 3.6

>gb|BC089149.1| Xenopus laevis cDNA clone MGC:85067 IMAGE:6327400, complete cds
          Length = 3064

 Score = 42.1 bits (21), Expect = 0.23
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 42   ttctggaagcctacacgaaga 62
            |||||||||||||||||||||
Sbjct: 1622 ttctggaagcctacacgaaga 1642



to top

>gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete sequence
          Length = 176395

 Score = 40.1 bits (20), Expect = 0.92
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     gaccaaaccaagttctggaa 49
              ||||||||||||||||||||
Sbjct: 102983 gaccaaaccaagttctggaa 102964



to top

>gb|AC102792.7| Mus musculus chromosome 7, clone RP23-370I17, complete sequence
          Length = 215999

 Score = 40.1 bits (20), Expect = 0.92
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    aaaggctttccctgaccaaa 36
             ||||||||||||||||||||
Sbjct: 83966 aaaggctttccctgaccaaa 83985



to top

>gb|AE003704.3| Drosophila melanogaster chromosome 3R, section 42 of 118 of the complete
              sequence
          Length = 220679

 Score = 40.1 bits (20), Expect = 0.92
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 30     gaccaaaccaagttctggaa 49
              ||||||||||||||||||||
Sbjct: 202720 gaccaaaccaagttctggaa 202739



to top

>gb|AC009395.7| Drosophila melanogaster clone BACR01D01, complete sequence
          Length = 189116

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 5     tagatacatctcaaaggctttcc 27
             ||||||||||||||||| |||||
Sbjct: 13617 tagatacatctcaaaggatttcc 13595



to top

>gb|AC009736.10| Drosophila melanogaster clone BACR10A04, complete sequence
          Length = 165489

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 5     tagatacatctcaaaggctttcc 27
             ||||||||||||||||| |||||
Sbjct: 90512 tagatacatctcaaaggatttcc 90490



to top

>emb|Z83001.1|HSG0453 Human DNA sequence from clone XX-G0453 on chromosome 11, complete
             sequence
          Length = 32246

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    aaaggctttccctgaccaa 35
             |||||||||||||||||||
Sbjct: 27521 aaaggctttccctgaccaa 27503



to top

>emb|AL590128.11| Human DNA sequence from clone RP11-312B8 on chromosome 1 Contains a
             novel gene, the 5' end of the CAMTA1 gene for calmodulin
             binding transcription activator 1, a ribosomal protein L37
             (RPL37) pseudogene and a CpG island, complete sequence
          Length = 204394

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 22    ctttccctgaccaaaccaa 40
             |||||||||||||||||||
Sbjct: 66824 ctttccctgaccaaaccaa 66806



to top

>emb|AL355309.27| Human DNA sequence from clone RP11-332E4 on chromosome Xq26.3-27.3
             Contains a ribosomal protein L28 (RPL28) pseudogene,
             complete sequence
          Length = 94784

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 19    aggctttccctgaccaaac 37
             |||||||||||||||||||
Sbjct: 54404 aggctttccctgaccaaac 54422



to top

>emb|AL035459.6|HS81G23 Human DNA sequence from clone RP1-81G23 on chromosome 20q12
           Contains part of the PTPRT gene for protein tyrosine
           phosphatase receptor type T, ESTs, STS and GSSs,
           complete sequence
          Length = 50348

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 45  tggaagcctacacgaagag 63
           |||||||||||||||||||
Sbjct: 436 tggaagcctacacgaagag 418



to top

>emb|AL731722.19| Mouse DNA sequence from clone RP23-57M16 on chromosome 4, complete
             sequence
          Length = 84483

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 16    caaaggctttccctgacca 34
             |||||||||||||||||||
Sbjct: 58893 caaaggctttccctgacca 58911



to top

>gb|AC113192.3| Homo sapiens chromosome 11, clone RP11-646J21, complete sequence
          Length = 148308

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 16    caaaggctttccctgacca 34
             |||||||||||||||||||
Sbjct: 14412 caaaggctttccctgacca 14394



to top

>gb|AC132216.7| Homo sapiens chromosome 11, clone RP13-786C16, complete sequence
          Length = 174373

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 16    caaaggctttccctgacca 34
             |||||||||||||||||||
Sbjct: 15932 caaaggctttccctgacca 15950



to top

>gb|AE003722.4| Drosophila melanogaster chromosome 3R, section 60 of 118 of the complete
              sequence
          Length = 221164

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 5      tagatacatctcaaaggctttcc 27
              ||||||||||||||||| |||||
Sbjct: 157750 tagatacatctcaaaggatttcc 157728


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 525,209
Number of Sequences: 3902068
Number of extensions: 525209
Number of successful extensions: 33252
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33224
Number of HSP's gapped (non-prelim): 28
length of query: 86
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 65
effective length of database: 17,151,101,840
effective search space: 1114821619600
effective search space used: 1114821619600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top