ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart53c11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ124210.1| Triticum aestivum glutamine synthetase isoform GS... 54 2e-05
2dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome 42 0.065
3gb|AC145797.2| Xenopus tropicalis clone CH216-22B13, complete se... 40 0.25
4gb|AC135780.2| Homo sapiens chromosome 16 clone CTD-2320F3, comp... 38 1.0
5emb|X69087.1|HVCGSA H.vulgare mRNA for cytoplasmic glutamine syn... 38 1.0
6gb|AC116667.2| Homo sapiens chromosome 16 clone RP11-346C20, com... 38 1.0
7gb|AE017308.1| Mycoplasma mobile 163K complete genome 36 4.0
8gb|AC148466.2| Xenopus tropicalis clone CH216-69C13, complete se... 36 4.0
9gb|AC114975.2| Homo sapiens chromosome 5 clone RP11-484L7, compl... 36 4.0
10gb|AC091735.3| Genomic sequence for Oryza sativa, Nipponbare str... 36 4.0
11dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 36 4.0
12dbj|AK070579.1| Oryza sativa (japonica cultivar-group) cDNA clon... 36 4.0
13gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 36 4.0

>gb|DQ124210.1| Triticum aestivum glutamine synthetase isoform GS1b (GS1) mRNA,
            complete cds
          Length = 1496

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 4    acgggccattttattaccatatcaatcgatgatta 38
            |||| ||||||||||||||||||||| ||||||||
Sbjct: 1463 acggaccattttattaccatatcaattgatgatta 1429



to top

>dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome
          Length = 1358633

 Score = 42.1 bits (21), Expect = 0.065
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 10     cattttattaccatatcaatc 30
              |||||||||||||||||||||
Sbjct: 345742 cattttattaccatatcaatc 345722



 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 13     tttattaccatatcaatc 30
              ||||||||||||||||||
Sbjct: 355769 tttattaccatatcaatc 355752



to top

>gb|AC145797.2| Xenopus tropicalis clone CH216-22B13, complete sequence
          Length = 142988

 Score = 40.1 bits (20), Expect = 0.25
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     gacgggccattttattacca 22
             ||||||||||||||||||||
Sbjct: 36849 gacgggccattttattacca 36830



to top

>gb|AC135780.2| Homo sapiens chromosome 16 clone CTD-2320F3, complete sequence
          Length = 125603

 Score = 38.2 bits (19), Expect = 1.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    cattttattaccatatcaa 28
             |||||||||||||||||||
Sbjct: 45903 cattttattaccatatcaa 45885



to top

>emb|X69087.1|HVCGSA H.vulgare mRNA for cytoplasmic glutamine synthetase
          Length = 1456

 Score = 38.2 bits (19), Expect = 1.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 12   ttttattaccatatcaatc 30
            |||||||||||||||||||
Sbjct: 1387 ttttattaccatatcaatc 1369



to top

>gb|AC116667.2| Homo sapiens chromosome 16 clone RP11-346C20, complete sequence
          Length = 156100

 Score = 38.2 bits (19), Expect = 1.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    cattttattaccatatcaa 28
             |||||||||||||||||||
Sbjct: 65736 cattttattaccatatcaa 65754



to top

>gb|AE017308.1| Mycoplasma mobile 163K complete genome
          Length = 777079

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 9      ccattttattaccatatc 26
              ||||||||||||||||||
Sbjct: 106343 ccattttattaccatatc 106326



to top

>gb|AC148466.2| Xenopus tropicalis clone CH216-69C13, complete sequence
          Length = 177332

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     attttattaccatatcaa 28
              ||||||||||||||||||
Sbjct: 150817 attttattaccatatcaa 150834



to top

>gb|AC114975.2| Homo sapiens chromosome 5 clone RP11-484L7, complete sequence
          Length = 197363

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     cattttattaccatatca 27
              ||||||||||||||||||
Sbjct: 118698 cattttattaccatatca 118681



to top

>gb|AC091735.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0082N11, from chromosome 10, complete sequence
          Length = 183345

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    cattttattaccatatca 27
             ||||||||||||||||||
Sbjct: 26324 cattttattaccatatca 26307



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 10      cattttattaccatatca 27
               ||||||||||||||||||
Sbjct: 7392460 cattttattaccatatca 7392443



to top

>dbj|AK070579.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023060P21, full
           insert sequence
          Length = 1175

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 10  cattttattaccatatca 27
           ||||||||||||||||||
Sbjct: 978 cattttattaccatatca 961



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 10      cattttattaccatatca 27
               ||||||||||||||||||
Sbjct: 7396659 cattttattaccatatca 7396642


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 235,705
Number of Sequences: 3902068
Number of extensions: 235705
Number of successful extensions: 62116
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62050
Number of HSP's gapped (non-prelim): 66
length of query: 38
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 18
effective length of database: 17,155,003,908
effective search space: 308790070344
effective search space used: 308790070344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top