Clone Name | rbart53c11 |
---|---|
Clone Library Name | barley_pub |
>gb|DQ124210.1| Triticum aestivum glutamine synthetase isoform GS1b (GS1) mRNA, complete cds Length = 1496 Score = 54.0 bits (27), Expect = 2e-05 Identities = 33/35 (94%) Strand = Plus / Minus Query: 4 acgggccattttattaccatatcaatcgatgatta 38 |||| ||||||||||||||||||||| |||||||| Sbjct: 1463 acggaccattttattaccatatcaattgatgatta 1429
>dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome Length = 1358633 Score = 42.1 bits (21), Expect = 0.065 Identities = 21/21 (100%) Strand = Plus / Minus Query: 10 cattttattaccatatcaatc 30 ||||||||||||||||||||| Sbjct: 345742 cattttattaccatatcaatc 345722 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 13 tttattaccatatcaatc 30 |||||||||||||||||| Sbjct: 355769 tttattaccatatcaatc 355752
>gb|AC145797.2| Xenopus tropicalis clone CH216-22B13, complete sequence Length = 142988 Score = 40.1 bits (20), Expect = 0.25 Identities = 20/20 (100%) Strand = Plus / Minus Query: 3 gacgggccattttattacca 22 |||||||||||||||||||| Sbjct: 36849 gacgggccattttattacca 36830
>gb|AC135780.2| Homo sapiens chromosome 16 clone CTD-2320F3, complete sequence Length = 125603 Score = 38.2 bits (19), Expect = 1.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 10 cattttattaccatatcaa 28 ||||||||||||||||||| Sbjct: 45903 cattttattaccatatcaa 45885
>emb|X69087.1|HVCGSA H.vulgare mRNA for cytoplasmic glutamine synthetase Length = 1456 Score = 38.2 bits (19), Expect = 1.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 12 ttttattaccatatcaatc 30 ||||||||||||||||||| Sbjct: 1387 ttttattaccatatcaatc 1369
>gb|AC116667.2| Homo sapiens chromosome 16 clone RP11-346C20, complete sequence Length = 156100 Score = 38.2 bits (19), Expect = 1.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 10 cattttattaccatatcaa 28 ||||||||||||||||||| Sbjct: 65736 cattttattaccatatcaa 65754
>gb|AE017308.1| Mycoplasma mobile 163K complete genome Length = 777079 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 9 ccattttattaccatatc 26 |||||||||||||||||| Sbjct: 106343 ccattttattaccatatc 106326
>gb|AC148466.2| Xenopus tropicalis clone CH216-69C13, complete sequence Length = 177332 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 11 attttattaccatatcaa 28 |||||||||||||||||| Sbjct: 150817 attttattaccatatcaa 150834
>gb|AC114975.2| Homo sapiens chromosome 5 clone RP11-484L7, complete sequence Length = 197363 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 10 cattttattaccatatca 27 |||||||||||||||||| Sbjct: 118698 cattttattaccatatca 118681
>gb|AC091735.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0082N11, from chromosome 10, complete sequence Length = 183345 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 10 cattttattaccatatca 27 |||||||||||||||||| Sbjct: 26324 cattttattaccatatca 26307
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 10 cattttattaccatatca 27 |||||||||||||||||| Sbjct: 7392460 cattttattaccatatca 7392443
>dbj|AK070579.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023060P21, full insert sequence Length = 1175 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 10 cattttattaccatatca 27 |||||||||||||||||| Sbjct: 978 cattttattaccatatca 961
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 10 cattttattaccatatca 27 |||||||||||||||||| Sbjct: 7396659 cattttattaccatatca 7396642 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 235,705 Number of Sequences: 3902068 Number of extensions: 235705 Number of successful extensions: 62116 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 13 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 62050 Number of HSP's gapped (non-prelim): 66 length of query: 38 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 18 effective length of database: 17,155,003,908 effective search space: 308790070344 effective search space used: 308790070344 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)