ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart53b07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_450517.1| Oryza sativa (japonica cultivar-group), mRNA 88 1e-14
2dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-14
3dbj|AP005879.3| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-14
4tpe|BN000650.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-gr... 88 1e-14
5dbj|AP005593.3| Oryza sativa (japonica cultivar-group) genomic D... 80 3e-12
6tpe|BN000649.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-gr... 80 3e-12
7ref|XM_388296.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 42 0.56
8ref|XM_510435.1| PREDICTED: Pan troglodytes similar to hypotheti... 40 2.2
9ref|XM_869486.1| PREDICTED: Bos taurus similar to suppressor of ... 40 2.2
10ref|NM_017661.2| Homo sapiens suppressor of hairy wing homolog 4... 40 2.2
11ref|NM_001002843.1| Homo sapiens suppressor of hairy wing homolo... 40 2.2
12gb|AC134440.3| Mus musculus BAC clone RP24-528L1 from chromosome... 40 2.2
13gb|AC122359.5| Mus musculus BAC clone RP23-421B1 from chromosome... 40 2.2
14gb|BC036541.1| Homo sapiens cDNA clone IMAGE:4829311, with appar... 40 2.2
15gb|AC087259.18| Homo sapiens 12p BAC RP11-387J7 (Roswell Park Ca... 40 2.2
16gb|AC073504.18|AC073504 Homo sapiens 12 BAC RP11-6C16 (Roswell P... 40 2.2
17gb|AC090518.2|AC090518 Homo sapiens chromosome 15 clone RP11-566... 40 2.2
18gb|BC040532.1| Homo sapiens suppressor of hairy wing homolog 4 (... 40 2.2
19emb|BX641000.1|HSM807164 Homo sapiens mRNA; cDNA DKFZp686H13148 ... 40 2.2
20emb|BX640707.1|HSM806777 Homo sapiens mRNA; cDNA DKFZp686F11161 ... 40 2.2
21emb|BX640637.1|HSM806683 Homo sapiens mRNA; cDNA DKFZp779P138 (f... 40 2.2
22dbj|AK000093.1| Homo sapiens cDNA FLJ20086 fis, clone COL03629 40 2.2
23dbj|AK025073.1| Homo sapiens cDNA: FLJ21420 fis, clone COL04105 40 2.2
24emb|BX248499.12| Zebrafish DNA sequence from clone CH211-284A13 ... 40 2.2
25dbj|AB046804.1| Homo sapiens mRNA for KIAA1584 protein, partial cds 40 2.2
26ref|NM_120317.1| Arabidopsis thaliana unknown protein AT5G02390 ... 38 8.8
27gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 38 8.8
28gb|AC018491.9| Drosophila melanogaster clone BACR11H15, complete... 38 8.8
29ref|XM_958388.1| Neurospora crassa OR74A hypothetical protein ( ... 38 8.8
30ref|XM_325247.1| Neurospora crassa OR74A hypothetical protein ( ... 38 8.8
31ref|NM_172746.2| Mus musculus HIRA interacting protein 3 (Hirip3... 38 8.8
32emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 38 8.8
33gb|AC122863.4| Mus musculus BAC clone RP23-142A14 from chromosom... 38 8.8
34ref|XM_721771.1| Plasmodium yoelii yoelii str. 17XNL nuclear dis... 38 8.8
35emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB 38 8.8
36emb|AL389900.2|NCB15I20 Neurospora crassa DNA linkage group II B... 38 8.8
37emb|AL162874.1|ATT1E22 Arabidopsis thaliana DNA chromosome 5, BA... 38 8.8
38dbj|AK135526.1| Mus musculus 12 days embryo female mullerian duc... 38 8.8
39dbj|AK162096.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 38 8.8
40dbj|AK161657.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 38 8.8
41gb|AC161470.3| Gallus gallus BAC clone CH261-85J8 from chromosom... 38 8.8
42gb|AC158356.2| Mus musculus BAC clone RP23-475P8 from chromosome... 38 8.8
43dbj|AK045122.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 38 8.8
44gb|AC009482.4| Homo sapiens BAC clone RP11-303F17 from 2, comple... 38 8.8
45gb|AY576273.1| Bacteriophage Phi JL001, complete genome 38 8.8
46emb|AL451011.1|NCB16L14 Neurospora crassa DNA linkage group II B... 38 8.8
47gb|AE002611.5| Drosophila melanogaster chromosome X, section 66 ... 38 8.8
48gb|AC107045.9| Mus musculus chromosome 1, clone RP23-334J7, comp... 38 8.8
49gb|BC055687.1| Mus musculus HIRA interacting protein 3, mRNA (cD... 38 8.8
50gb|AC124505.4| Mus musculus BAC clone RP23-421P23 from 7, comple... 38 8.8
51emb|CT025556.12| Mouse DNA sequence from clone RP24-91G8 on chro... 38 8.8
52gb|AC161927.11| Mus musculus chromosome 1, clone RP23-22I18, com... 38 8.8 
>ref|XM_450517.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 987

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 67  agttgaacttgctgcagaccctgcggacctccccctgtgtgccggtaagcaccttgacct 126
           |||||||||||||||||||| |||||| ||| ||||| |  ||||| ||||| |||||||
Sbjct: 985 agttgaacttgctgcagaccttgcggatctctccctgagctccggtgagcacgttgacct 926

                                           
Query: 127 cccccagcttgacgagggcctgcgggaagagc 158
           | || ||||||| ||| |||||||||||||||
Sbjct: 925 cgccgagcttgatgagcgcctgcgggaagagc 894
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                           
Query: 67      agttgaacttgctgcagaccctgcggacctccccctgtgtgccggtaagcaccttgacct 126
               |||||||||||||||||||| |||||| ||| ||||| |  ||||| ||||| |||||||
Sbjct: 9434271 agttgaacttgctgcagaccttgcggatctctccctgagctccggtgagcacgttgacct 9434212

                                               
Query: 127     cccccagcttgacgagggcctgcgggaagagc 158
               | || ||||||| ||| |||||||||||||||
Sbjct: 9434211 cgccgagcttgatgagcgcctgcgggaagagc 9434180



 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                           
Query: 67      agttgaacttgctgcagaccctgcggacctccccctgtgtgccggtaagcaccttgacct 126
               |||||||||||||||||||| |||||| ||| ||||| |  ||||| | ||| |||||||
Sbjct: 9438619 agttgaacttgctgcagaccttgcggatctctccctgagctccggtgatcacgttgacct 9438678

                                               
Query: 127     cccccagcttgacgagggcctgcgggaagagc 158
               | || ||||||| ||| |||||||||||||||
Sbjct: 9438679 cgccgagcttgatgagcgcctgcgggaagagc 9438710
to top
>dbj|AP005879.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0024J13
          Length = 127614

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                          
Query: 67     agttgaacttgctgcagaccctgcggacctccccctgtgtgccggtaagcaccttgacct 126
              |||||||||||||||||||| |||||| ||| ||||| |  ||||| ||||| |||||||
Sbjct: 117685 agttgaacttgctgcagaccttgcggatctctccctgagctccggtgagcacgttgacct 117626

                                              
Query: 127    cccccagcttgacgagggcctgcgggaagagc 158
              | || ||||||| ||| |||||||||||||||
Sbjct: 117625 cgccgagcttgatgagcgcctgcgggaagagc 117594



 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                          
Query: 67     agttgaacttgctgcagaccctgcggacctccccctgtgtgccggtaagcaccttgacct 126
              |||||||||||||||||||| |||||| ||| ||||| |  ||||| | ||| |||||||
Sbjct: 122033 agttgaacttgctgcagaccttgcggatctctccctgagctccggtgatcacgttgacct 122092

                                              
Query: 127    cccccagcttgacgagggcctgcgggaagagc 158
              | || ||||||| ||| |||||||||||||||
Sbjct: 122093 cgccgagcttgatgagcgcctgcgggaagagc 122124
to top
>tpe|BN000650.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-group) prx121 gene for
            class III peroxidase 121 precursor, exons 1-2
          Length = 1070

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                        
Query: 67   agttgaacttgctgcagaccctgcggacctccccctgtgtgccggtaagcaccttgacct 126
            |||||||||||||||||||| |||||| ||| ||||| |  ||||| ||||| |||||||
Sbjct: 1068 agttgaacttgctgcagaccttgcggatctctccctgagctccggtgagcacgttgacct 1009

                                            
Query: 127  cccccagcttgacgagggcctgcgggaagagc 158
            | || ||||||| ||| |||||||||||||||
Sbjct: 1008 cgccgagcttgatgagcgcctgcgggaagagc 977
to top
>dbj|AP005593.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
            clone:P0692F07
          Length = 141544

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                        
Query: 67   agttgaacttgctgcagaccctgcggacctccccctgtgtgccggtaagcaccttgacct 126
            |||||||||||||||||||| |||||| ||| ||||| |  ||||| | ||| |||||||
Sbjct: 2255 agttgaacttgctgcagaccttgcggatctctccctgagctccggtgatcacgttgacct 2314

                                            
Query: 127  cccccagcttgacgagggcctgcgggaagagc 158
            | || ||||||| ||| |||||||||||||||
Sbjct: 2315 cgccgagcttgatgagcgcctgcgggaagagc 2346
to top
>tpe|BN000649.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-group) prx120 gene for
            class III peroxidase 120 precursor, exons 1-2
          Length = 1077

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 67   agttgaacttgctgcagaccctgcggacctccccctgtgtgccggtaagcaccttgacct 126
            |||||||||||||||||||| |||||| ||| ||||| |  ||||| | ||| |||||||
Sbjct: 1075 agttgaacttgctgcagaccttgcggatctctccctgagctccggtgatcacgttgacct 1016

                                            
Query: 127  cccccagcttgacgagggcctgcgggaagagc 158
            | || ||||||| ||| |||||||||||||||
Sbjct: 1015 cgccgagcttgatgagcgcctgcgggaagagc 984
to top
>ref|XM_388296.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08120.1)
           partial mRNA
          Length = 1977

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 60  tctcatcagttgaacttgctg 80
           |||||||||||||||||||||
Sbjct: 576 tctcatcagttgaacttgctg 556
to top
>ref|XM_510435.1| PREDICTED: Pan troglodytes similar to hypothetical protein
            (LOC453464), mRNA
          Length = 3291

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 1399 tcagaaaatgatgatgatct 1380
to top
>ref|XM_869486.1| PREDICTED: Bos taurus similar to suppressor of hairy wing homolog 4
            isoform 1 (LOC617261), partial mRNA
          Length = 1391

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 1267 tcagaaaatgatgatgatct 1248
to top
>ref|NM_017661.2| Homo sapiens suppressor of hairy wing homolog 4 (Drosophila) (SUHW4),
            transcript variant 1, mRNA
          Length = 4484

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 1512 tcagaaaatgatgatgatct 1493
to top
>ref|NM_001002843.1| Homo sapiens suppressor of hairy wing homolog 4 (Drosophila) (SUHW4),
            transcript variant 2, mRNA
          Length = 4415

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 1443 tcagaaaatgatgatgatct 1424
to top
>gb|AC134440.3| Mus musculus BAC clone RP24-528L1 from chromosome 18, complete sequence
          Length = 152907

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aatgatgatgatctcatcag 68
             ||||||||||||||||||||
Sbjct: 28422 aatgatgatgatctcatcag 28403
to top
>gb|AC122359.5| Mus musculus BAC clone RP23-421B1 from chromosome 6, complete sequence
          Length = 194338

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     aaagtaaacacaaaagtttc 23
             ||||||||||||||||||||
Sbjct: 65363 aaagtaaacacaaaagtttc 65344
to top
>gb|BC036541.1| Homo sapiens cDNA clone IMAGE:4829311, with apparent retained intron
          Length = 4811

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 3061 tcagaaaatgatgatgatct 3042
to top
>gb|AC087259.18| Homo sapiens 12p BAC RP11-387J7 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 130000

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     gtaaacacaaaagtttcgcc 26
             ||||||||||||||||||||
Sbjct: 25415 gtaaacacaaaagtttcgcc 25396
to top
>gb|AC073504.18|AC073504 Homo sapiens 12 BAC RP11-6C16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 155818

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     gtaaacacaaaagtttcgcc 26
             ||||||||||||||||||||
Sbjct: 10883 gtaaacacaaaagtttcgcc 10864
to top
>gb|AC090518.2|AC090518 Homo sapiens chromosome 15 clone RP11-566D24 map 15q21.3, complete
              sequence
          Length = 188644

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 43     tcagaaaatgatgatgatct 62
              ||||||||||||||||||||
Sbjct: 151838 tcagaaaatgatgatgatct 151857
to top
>gb|BC040532.1| Homo sapiens suppressor of hairy wing homolog 4 (Drosophila), mRNA
            (cDNA clone IMAGE:5261474)
          Length = 4952

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 1941 tcagaaaatgatgatgatct 1922
to top
>emb|BX641000.1|HSM807164 Homo sapiens mRNA; cDNA DKFZp686H13148 (from clone DKFZp686H13148);
            complete cds
          Length = 4414

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 1434 tcagaaaatgatgatgatct 1415
to top
>emb|BX640707.1|HSM806777 Homo sapiens mRNA; cDNA DKFZp686F11161 (from clone DKFZp686F11161);
            complete cds
          Length = 4346

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 1513 tcagaaaatgatgatgatct 1494
to top
>emb|BX640637.1|HSM806683 Homo sapiens mRNA; cDNA DKFZp779P138 (from clone DKFZp779P138);
            complete cds
          Length = 4152

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 1457 tcagaaaatgatgatgatct 1438
to top
>dbj|AK000093.1| Homo sapiens cDNA FLJ20086 fis, clone COL03629
          Length = 3572

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 43  tcagaaaatgatgatgatct 62
           ||||||||||||||||||||
Sbjct: 454 tcagaaaatgatgatgatct 435
to top
>dbj|AK025073.1| Homo sapiens cDNA: FLJ21420 fis, clone COL04105
          Length = 2091

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 43  tcagaaaatgatgatgatct 62
           ||||||||||||||||||||
Sbjct: 979 tcagaaaatgatgatgatct 960
to top
>emb|BX248499.12| Zebrafish DNA sequence from clone CH211-284A13 in linkage group 19,
              complete sequence
          Length = 148683

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      aaagtaaacacaaaagtttc 23
              ||||||||||||||||||||
Sbjct: 133024 aaagtaaacacaaaagtttc 133005
to top
>dbj|AB046804.1| Homo sapiens mRNA for KIAA1584 protein, partial cds
          Length = 4306

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tcagaaaatgatgatgatct 62
            ||||||||||||||||||||
Sbjct: 1344 tcagaaaatgatgatgatct 1325
to top
>ref|NM_120317.1| Arabidopsis thaliana unknown protein AT5G02390 mRNA, complete cds
          Length = 2508

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 42  ctcagaaaatgatgatgat 60
           |||||||||||||||||||
Sbjct: 816 ctcagaaaatgatgatgat 834
to top
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 48   aaatgatgatgatctcatc 66
            |||||||||||||||||||
Sbjct: 6216 aaatgatgatgatctcatc 6234
to top
>gb|AC018491.9| Drosophila melanogaster clone BACR11H15, complete sequence
          Length = 177953

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 14     caaaagtttcgccattatc 32
              |||||||||||||||||||
Sbjct: 155849 caaaagtttcgccattatc 155831
to top
>ref|XM_958388.1| Neurospora crassa OR74A hypothetical protein ( hypothetical protein
            B15I20.40 [imported] - Neurospora crassa OR74A )
            (NCU05393.1) partial mRNA
          Length = 2118

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 50   atgatgatgatctcatcag 68
            |||||||||||||||||||
Sbjct: 1472 atgatgatgatctcatcag 1490
to top
>ref|XM_325247.1| Neurospora crassa OR74A hypothetical protein ( hypothetical protein
            B15I20.40 [imported] - Neurospora crassa OR74A )
            (NCU05393.1) partial mRNA
          Length = 2118

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 50   atgatgatgatctcatcag 68
            |||||||||||||||||||
Sbjct: 1472 atgatgatgatctcatcag 1490
to top
>ref|NM_172746.2| Mus musculus HIRA interacting protein 3 (Hirip3), mRNA
          Length = 2685

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 148  gcgggaagagccagctgaagtgg 170
            |||||||||| ||||||||||||
Sbjct: 2064 gcgggaagaggcagctgaagtgg 2086
to top
>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 72      aacttgctgcagaccctgc 90
               |||||||||||||||||||
Sbjct: 1791088 aacttgctgcagaccctgc 1791070
to top
>gb|AC122863.4| Mus musculus BAC clone RP23-142A14 from chromosome 7, complete
            sequence
          Length = 226601

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 148  gcgggaagagccagctgaagtgg 170
            |||||||||| ||||||||||||
Sbjct: 5337 gcgggaagaggcagctgaagtgg 5359
to top
>ref|XM_721771.1| Plasmodium yoelii yoelii str. 17XNL nuclear distribution gene C
           (PY06251) partial mRNA
          Length = 1017

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 42  ctcagaaaatgatgatgat 60
           |||||||||||||||||||
Sbjct: 435 ctcagaaaatgatgatgat 453
to top
>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB
          Length = 1683333

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 133    gcttgacgagggcctgcgggaag 155
              |||||||||||||| ||||||||
Sbjct: 154044 gcttgacgagggccggcgggaag 154066
to top
>emb|AL389900.2|NCB15I20 Neurospora crassa DNA linkage group II BAC clone B15I20
          Length = 47481

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 50    atgatgatgatctcatcag 68
             |||||||||||||||||||
Sbjct: 11362 atgatgatgatctcatcag 11380
to top
>emb|AL162874.1|ATT1E22 Arabidopsis thaliana DNA chromosome 5, BAC clone T1E22 (ESSA project)
          Length = 96575

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    ctcagaaaatgatgatgat 60
             |||||||||||||||||||
Sbjct: 59492 ctcagaaaatgatgatgat 59474
to top
>dbj|AK135526.1| Mus musculus 12 days embryo female mullerian duct includes
            surrounding region cDNA, RIKEN full-length enriched
            library, clone:6820443M23 product:weakly similar to
            HIRA-interacting protein 3 [Homo sapiens], full insert
            sequence
          Length = 2313

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 148  gcgggaagagccagctgaagtgg 170
            |||||||||| ||||||||||||
Sbjct: 1609 gcgggaagaggcagctgaagtgg 1631
to top
>dbj|AK162096.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420409G16 product:hypothetical
           Serine-rich region profile containing protein, full
           insert sequence
          Length = 1073

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 148 gcgggaagagccagctgaagtgg 170
           |||||||||| ||||||||||||
Sbjct: 626 gcgggaagaggcagctgaagtgg 648
to top
>dbj|AK161657.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:5730444G21 product:weakly similar
            to HIRA-interacting protein 3 [Homo sapiens], full insert
            sequence
          Length = 2046

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 148  gcgggaagagccagctgaagtgg 170
            |||||||||| ||||||||||||
Sbjct: 1599 gcgggaagaggcagctgaagtgg 1621
to top
>gb|AC161470.3| Gallus gallus BAC clone CH261-85J8 from chromosome ul, complete
             sequence
          Length = 213142

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 151   ggaagagccagctgaagtg 169
             |||||||||||||||||||
Sbjct: 97141 ggaagagccagctgaagtg 97159
to top
>gb|AC158356.2| Mus musculus BAC clone RP23-475P8 from chromosome 13, complete sequence
          Length = 210995

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 36    tgtttcctcagaaaatgat 54
             |||||||||||||||||||
Sbjct: 57795 tgtttcctcagaaaatgat 57777
to top
>dbj|AK045122.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
            enriched library, clone:B130036O03 product:weakly similar
            to HIRIP3 PROTEIN [Homo sapiens], full insert sequence
          Length = 2046

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 148  gcgggaagagccagctgaagtgg 170
            |||||||||| ||||||||||||
Sbjct: 1599 gcgggaagaggcagctgaagtgg 1621
to top
>gb|AC009482.4| Homo sapiens BAC clone RP11-303F17 from 2, complete sequence
          Length = 109582

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    agaaaatgatgatgatctc 63
             |||||||||||||||||||
Sbjct: 50095 agaaaatgatgatgatctc 50077
to top
>gb|AY576273.1| Bacteriophage Phi JL001, complete genome
          Length = 63649

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 129   cccagcttgacgagggcct 147
             |||||||||||||||||||
Sbjct: 26631 cccagcttgacgagggcct 26613
to top
>emb|AL451011.1|NCB16L14 Neurospora crassa DNA linkage group II BAC clone B16L14
          Length = 35066

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 50  atgatgatgatctcatcag 68
           |||||||||||||||||||
Sbjct: 449 atgatgatgatctcatcag 431
to top
>gb|AE002611.5| Drosophila melanogaster chromosome X, section 66 of 74 of the complete
              sequence
          Length = 297848

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 14     caaaagtttcgccattatc 32
              |||||||||||||||||||
Sbjct: 246711 caaaagtttcgccattatc 246693
to top
>gb|AC107045.9| Mus musculus chromosome 1, clone RP23-334J7, complete sequence
          Length = 222700

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 8      taaacacaaaagtttcgcc 26
              |||||||||||||||||||
Sbjct: 197200 taaacacaaaagtttcgcc 197218
to top
>gb|BC055687.1| Mus musculus HIRA interacting protein 3, mRNA (cDNA clone MGC:66546
            IMAGE:6414655), complete cds
          Length = 2685

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 148  gcgggaagagccagctgaagtgg 170
            |||||||||| ||||||||||||
Sbjct: 2064 gcgggaagaggcagctgaagtgg 2086
to top
>gb|AC124505.4| Mus musculus BAC clone RP23-421P23 from 7, complete sequence
          Length = 222439

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 148    gcgggaagagccagctgaagtgg 170
              |||||||||| ||||||||||||
Sbjct: 205371 gcgggaagaggcagctgaagtgg 205393
to top
>emb|CT025556.12| Mouse DNA sequence from clone RP24-91G8 on chromosome 13, complete
              sequence
          Length = 225239

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 36     tgtttcctcagaaaatgat 54
              |||||||||||||||||||
Sbjct: 156430 tgtttcctcagaaaatgat 156412
to top
>gb|AC161927.11| Mus musculus chromosome 1, clone RP23-22I18, complete sequence
          Length = 223377

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 8   taaacacaaaagtttcgcc 26
           |||||||||||||||||||
Sbjct: 421 taaacacaaaagtttcgcc 439


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,861,478
Number of Sequences: 3902068
Number of extensions: 1861478
Number of successful extensions: 182762
Number of sequences better than 10.0: 52
Number of HSP's better than 10.0 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 182559
Number of HSP's gapped (non-prelim): 203
length of query: 179
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 157
effective length of database: 17,147,199,772
effective search space: 2692110364204
effective search space used: 2692110364204
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top