ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart53b05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY968589.1| Triticum aestivum ice recrystallization inhibitio... 64 4e-07
2gb|AC121079.20| Mus musculus chromosome 3, clone RP24-178P12, co... 46 0.088
3gb|AC104329.22| Mus musculus strain C57BL/6J clone rp23-418c12 m... 46 0.088
4emb|AL731546.4| Human DNA sequence from clone RP11-293L1 on chro... 46 0.088
5gb|AC104632.10| Mus musculus strain C57BL/6J clone rp23-368d24 m... 46 0.088
6gb|AC171273.1| Mus musculus BAC clone RP23-137J12 from chromosom... 46 0.088
7emb|AL672194.1| Mouse DNA sequence from clone RP23-73P3 on chrom... 46 0.088
8gb|DQ366715.1| Uncultured Prochlorococcus marinus clone ASNC2259... 44 0.35
9emb|BX248318.9| Zebrafish DNA sequence from clone CH211-220M17 i... 44 0.35
10gb|AC158767.3| Mus musculus chromosome 1, clone RP24-128E5, comp... 42 1.4
11gb|AC124765.2| Mus musculus BAC clone RP23-197D9 from 2, complet... 42 1.4
12emb|AL357037.13| Human DNA sequence from clone RP11-383B24 on ch... 42 1.4
13emb|CR933813.6| Zebrafish DNA sequence from clone CH73-227I15 in... 42 1.4
14gb|AY968588.1| Triticum aestivum ice recrystallization inhibitio... 42 1.4
15emb|BX942820.7| Zebrafish DNA sequence from clone CH211-222L23 i... 42 1.4
16gb|AC158674.10| Mus musculus 6 BAC RP23-54E12 (Roswell Park Canc... 42 1.4
17gb|AC069462.3| Homo sapiens chromosome 3 clone RP11-271E2 map 3p... 42 1.4
18gb|AC117771.17| Mus musculus chromosome 1, clone RP24-512A5, com... 42 1.4
19emb|AL133453.3|CNS01DV4 Human chromosome 14 DNA sequence BAC R-8... 42 1.4
20emb|AL844840.8| Mouse DNA sequence from clone RP23-337P9 on chro... 42 1.4
21gb|AC004518.1|AC004518 Homo sapiens chromosome 14, BAC CITB-135H... 42 1.4
22emb|AL589168.3|CNS07EG1 Human chromosome 14 DNA sequence BAC R-1... 42 1.4
23gb|AC115818.9| Mus musculus chromosome 1, clone RP23-433A12, com... 40 5.4
24gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, co... 40 5.4
25emb|BX546457.1| Human DNA sequence from clone RP11-29O12 on chro... 40 5.4
26emb|AL359710.15| Human DNA sequence from clone RP11-30L7 on chro... 40 5.4
27emb|AL358237.13| Human DNA sequence from clone RP3-407G6 on chro... 40 5.4
28gb|AC016885.16| Homo sapiens chromosome 8, clone RP11-388K12, co... 40 5.4
29gb|AC157787.6| Mus musculus chromosome 1, clone RP23-158A6, comp... 40 5.4
30gb|AC063948.44| Homo sapiens 12 BAC RP11-321F8 (Roswell Park Can... 40 5.4
31gb|AF503628.1| Homo sapiens prostate apoptosis response protein ... 40 5.4
32gb|AC164663.5| Mus musculus 10 BAC RP23-44F24 (Roswell Park Canc... 40 5.4
33emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chrom... 40 5.4
34emb|AL161592.2|ATCHRIV88 Arabidopsis thaliana DNA chromosome 4, ... 40 5.4
35emb|AL035709.1|ATT28I19 Arabidopsis thaliana DNA chromosome 4, B... 40 5.4
36emb|CR388046.14| Zebrafish DNA sequence from clone DKEY-50E6 in ... 40 5.4
37gb|AC027449.6| Homo sapiens chromosome 18, clone RP11-535A5, com... 40 5.4
38gb|AC022825.9| Homo sapiens chromosome 8, clone RP11-88J22, comp... 40 5.4
39gb|AC135795.21| Medicago truncatula clone mth2-28g10, complete s... 40 5.4
40gb|AC154607.2| Mus musculus BAC clone RP23-331D17 from chromosom... 40 5.4
41gb|AC093560.2| Homo sapiens chromosome 1 clone RP11-398H19, comp... 40 5.4
42gb|AC023170.10| Homo sapiens chromosome 10 clone RP11-373P23, co... 40 5.4
43gb|AC073569.26| Homo sapiens 12 BAC RP11-530C5 (Roswell Park Can... 40 5.4
44gb|AC093677.4| Homo sapiens BAC clone RP11-629B11 from 4, comple... 40 5.4
45gb|AC022360.23| Homo sapiens 8 BAC RP11-58O3 (Roswell Park Cance... 40 5.4
46gb|AC150889.3| Medicago truncatula chromosome 7 BAC clone mte1-6... 40 5.4
47emb|BX296537.10| Zebrafish DNA sequence from clone CH211-249G3 i... 40 5.4
48tpg|BK000438.1| TPA: TPA_exp: Homo sapiens RING finger protein C... 40 5.4
49gb|AC084277.3| Homo sapiens BAC clone RP11-68O1 from 4, complete... 40 5.4
50gb|AC051630.4|AC051630 Arabidopsis thaliana chromosome 1 BAC F10... 40 5.4
51gb|AC018682.4| Homo sapiens BAC clone RP11-417F21 from 2, comple... 40 5.4
52gb|AC066690.6|AC066690 Arabidopsis thaliana chromosome 1 BAC F3A... 40 5.4
53gb|AC069556.4|AC069556 Genomic Sequence For Arabidopsis thaliana... 40 5.4
54gb|AC020646.2|AC020646 Genomic sequence for Arabidopsis thaliana... 40 5.4
55gb|AC007505.4|AC007505 Arabidopsis thaliana chromosome I BAC F28... 40 5.4
56emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in ... 40 5.4
57emb|AL355101.2|CNS05TCK Human chromosome 14 DNA sequence BAC R-6... 40 5.4
58gb|AC167700.2| Reniera sp. JGI-2005 clone JGIBAYC-5J13, complete... 40 5.4
59emb|AL590723.13| Human DNA sequence from clone RP11-492I21 on ch... 40 5.4
60emb|AL035605.1|ATF19F18 Arabidopsis thaliana DNA chromosome 4, B... 40 5.4
61gb|AC135019.3| Mus musculus BAC clone RP23-186D15 from 10, compl... 40 5.4
62emb|AL672307.9| Mouse DNA sequence from clone RP23-141N2 on chro... 40 5.4
63emb|AL596246.10| Mouse DNA sequence from clone RP23-186E14 on ch... 40 5.4
64gb|AY035396.1| Escherichia coli O91 O-antigen gene cluster, comp... 40 5.4
65dbj|AB030580.1| Homo sapiens DNA, breakpoint of inv(11)(q13,q25)... 40 5.4

>gb|AY968589.1| Triticum aestivum ice recrystallization inhibition protein 2
            precursor, mRNA, complete cds
          Length = 1596

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 238  actttgttgtccccagacacaatatggttcatcccagatacaacattgttgtttccggat 297
            |||||||| | |||||| || | ||||||  |||||||||||||||| ||| | || | |
Sbjct: 1235 actttgttattcccagatacgacatggtttctcccagatacaacattattgctcccagtt 1176

                                        
Query: 298  acgacattgttactccccgatacgacat 325
            ||||||||||| ||||| ||||||||||
Sbjct: 1175 acgacattgttcctcccggatacgacat 1148



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 297  tacgacattgttactccccgatacgacatggtt 329
            |||||| |||||| |||| ||||||||||||||
Sbjct: 1239 tacgactttgttattcccagatacgacatggtt 1207



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                        
Query: 269  tcccagatacaacattgttgtttccggatacgacattgttactccccgatacgacatggt 328
            |||||| ||| ||||||||  | ||||||||||||||||  ||||| || || |||||||
Sbjct: 1183 tcccagttacgacattgttcctcccggatacgacattgtcgctcccagaaacaacatggt 1124

             
Query: 329  t 329
            |
Sbjct: 1123 t 1123



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 295  gatacgacattgttactccc 314
            ||||||||||||||||||||
Sbjct: 1094 gatacgacattgttactccc 1075



to top

>gb|AC121079.20| Mus musculus chromosome 3, clone RP24-178P12, complete sequence
          Length = 177802

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 195   cttatagttgtacataaaataaa 217
             |||||||||||||||||||||||
Sbjct: 58002 cttatagttgtacataaaataaa 58024



to top

>gb|AC104329.22| Mus musculus strain C57BL/6J clone rp23-418c12 map 3, complete sequence
          Length = 197096

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 195    cttatagttgtacataaaataaa 217
              |||||||||||||||||||||||
Sbjct: 167796 cttatagttgtacataaaataaa 167774



to top

>emb|AL731546.4| Human DNA sequence from clone RP11-293L1 on chromosome 10, complete
             sequence
          Length = 92998

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 197   tatagttgtacataaaataaaat 219
             |||||||||||||||||||||||
Sbjct: 38404 tatagttgtacataaaataaaat 38382



to top

>gb|AC104632.10| Mus musculus strain C57BL/6J clone rp23-368d24 map 3, complete
            sequence
          Length = 210499

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 195  cttatagttgtacataaaataaa 217
            |||||||||||||||||||||||
Sbjct: 4862 cttatagttgtacataaaataaa 4840



to top

>gb|AC171273.1| Mus musculus BAC clone RP23-137J12 from chromosome 3, complete sequence
          Length = 234363

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 195    cttatagttgtacataaaataaa 217
              |||||||||||||||||||||||
Sbjct: 138254 cttatagttgtacataaaataaa 138232



to top

>emb|AL672194.1| Mouse DNA sequence from clone RP23-73P3 on chromosome 13, complete
             sequence
          Length = 173598

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 38    ttcttttgaaatgtacagtacat 60
             |||||||||||||||||||||||
Sbjct: 58722 ttcttttgaaatgtacagtacat 58744



to top

>gb|DQ366715.1| Uncultured Prochlorococcus marinus clone ASNC2259 genomic sequence
          Length = 35161

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 27    cacatatacttttcttttgaaa 48
             ||||||||||||||||||||||
Sbjct: 11331 cacatatacttttcttttgaaa 11352



to top

>emb|BX248318.9| Zebrafish DNA sequence from clone CH211-220M17 in linkage group 11,
             complete sequence
          Length = 194209

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 36    ttttcttttgaaatgtacagta 57
             ||||||||||||||||||||||
Sbjct: 77201 ttttcttttgaaatgtacagta 77222



to top

>gb|AC158767.3| Mus musculus chromosome 1, clone RP24-128E5, complete sequence
          Length = 188758

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 205    tacataaaataaaatcattaa 225
              |||||||||||||||||||||
Sbjct: 152141 tacataaaataaaatcattaa 152121



to top

>gb|AC124765.2| Mus musculus BAC clone RP23-197D9 from 2, complete sequence
          Length = 191781

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 203    tgtacataaaataaaatcatt 223
              |||||||||||||||||||||
Sbjct: 129791 tgtacataaaataaaatcatt 129771



to top

>emb|AL357037.13| Human DNA sequence from clone RP11-383B24 on chromosome 10 Contains the
              3' end of a 44kDA polymerase (RNA) III (DNA directed)
              polypeptide D (POLR3D) pseudogene, the 3' end of the ADK
              gene for adenosine kinase and a novel pseudogene, complete
              sequence
          Length = 165773

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1      acaacccaaaccataatatat 21
              |||||||||||||||||||||
Sbjct: 144816 acaacccaaaccataatatat 144836



to top

>emb|CR933813.6| Zebrafish DNA sequence from clone CH73-227I15 in linkage group 3,
             complete sequence
          Length = 97268

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 206   acataaaataaaatcattaac 226
             |||||||||||||||||||||
Sbjct: 51554 acataaaataaaatcattaac 51534



to top

>gb|AY968588.1| Triticum aestivum ice recrystallization inhibition protein 1
           precursor, mRNA, complete cds
          Length = 1079

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 297 tacgacattgttactccccgatacgacatggtt 329
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 930 tacgaccttgttgctcccagatacgacatggtt 898



to top

>emb|BX942820.7| Zebrafish DNA sequence from clone CH211-222L23 in linkage group 18,
             complete sequence
          Length = 114084

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 208   ataaaataaaatcattaacct 228
             |||||||||||||||||||||
Sbjct: 81203 ataaaataaaatcattaacct 81183



to top

>gb|AC158674.10| Mus musculus 6 BAC RP23-54E12 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 211124

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 206    acataaaataaaatcattaac 226
              |||||||||||||||||||||
Sbjct: 126131 acataaaataaaatcattaac 126111



to top

>gb|AC069462.3| Homo sapiens chromosome 3 clone RP11-271E2 map 3p, complete sequence
          Length = 161577

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1     acaacccaaaccataatatat 21
             |||||||||||||||||||||
Sbjct: 85044 acaacccaaaccataatatat 85064



to top

>gb|AC117771.17| Mus musculus chromosome 1, clone RP24-512A5, complete sequence
          Length = 161292

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 205   tacataaaataaaatcattaa 225
             |||||||||||||||||||||
Sbjct: 45706 tacataaaataaaatcattaa 45726



to top

>emb|AL133453.3|CNS01DV4 Human chromosome 14 DNA sequence BAC R-841O20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 212103

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 218   atcattaacctcctgatataa 238
             |||||||||||||||||||||
Sbjct: 51639 atcattaacctcctgatataa 51659



to top

>emb|AL844840.8| Mouse DNA sequence from clone RP23-337P9 on chromosome 2, complete
              sequence
          Length = 219568

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 203    tgtacataaaataaaatcatt 223
              |||||||||||||||||||||
Sbjct: 173220 tgtacataaaataaaatcatt 173240



to top

>gb|AC004518.1|AC004518 Homo sapiens chromosome 14, BAC CITB-135H17  containing the RAD51L1
             gene, complete sequence
          Length = 123661

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 121   ccttatgtaccttatttatccaaca 145
             ||||||||||||||||||| |||||
Sbjct: 59880 ccttatgtaccttatttattcaaca 59856



to top

>emb|AL589168.3|CNS07EG1 Human chromosome 14 DNA sequence BAC R-108B17 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 149805

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 121   ccttatgtaccttatttatccaaca 145
             ||||||||||||||||||| |||||
Sbjct: 75644 ccttatgtaccttatttattcaaca 75668



to top

>gb|AC115818.9| Mus musculus chromosome 1, clone RP23-433A12, complete sequence
          Length = 186895

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 206    acataaaataaaatcattaa 225
              ||||||||||||||||||||
Sbjct: 122947 acataaaataaaatcattaa 122928



to top

>gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, complete sequence
          Length = 192682

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    acataaaataaaatcattaa 225
              ||||||||||||||||||||
Sbjct: 190569 acataaaataaaatcattaa 190588



to top

>emb|BX546457.1| Human DNA sequence from clone RP11-29O12 on chromosome 1 Contains part
             of a novel gene (FLJ31487), complete sequence
          Length = 69971

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     ccaaaccataatatattaca 25
             ||||||||||||||||||||
Sbjct: 10254 ccaaaccataatatattaca 10273



to top

>emb|AL359710.15| Human DNA sequence from clone RP11-30L7 on chromosome 9 Contains part
             of a novel gene, the 5' end of the NR4A3 gene for nuclear
             receptor subfamily 4 group A, member 3 and two CpG
             islands, complete sequence
          Length = 174140

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 16    atatattacaacacatatactttt 39
             ||||||||||||||||||| ||||
Sbjct: 29943 atatattacaacacatatattttt 29966



to top

>emb|AL358237.13| Human DNA sequence from clone RP3-407G6 on chromosome 20 Contains part
             of a novel gene (LOC284757), complete sequence
          Length = 47850

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 210   aaaataaaatcattaacctcctga 233
             |||| |||||||||||||||||||
Sbjct: 47599 aaaaaaaaatcattaacctcctga 47622



to top

>gb|AC016885.16| Homo sapiens chromosome 8, clone RP11-388K12, complete sequence
          Length = 210008

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 47   aatgtacagtacatatactt 66
            ||||||||||||||||||||
Sbjct: 6507 aatgtacagtacatatactt 6488



to top

>gb|AC157787.6| Mus musculus chromosome 1, clone RP23-158A6, complete sequence
          Length = 199981

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   acataaaataaaatcattaa 225
             ||||||||||||||||||||
Sbjct: 35128 acataaaataaaatcattaa 35147



to top

>gb|AC063948.44| Homo sapiens 12 BAC RP11-321F8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 146502

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    ttttgaaatgtacagtacat 60
             ||||||||||||||||||||
Sbjct: 58192 ttttgaaatgtacagtacat 58173



to top

>gb|AF503628.1| Homo sapiens prostate apoptosis response protein PAR-4 gene, promoter
            region, 5'UTR and partial cds
          Length = 5935

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   aacacatatacttttctttt 44
            ||||||||||||||||||||
Sbjct: 1867 aacacatatacttttctttt 1848



to top

>gb|AC164663.5| Mus musculus 10 BAC RP23-44F24 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 192449

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    aacacatatacttttctttt 44
             ||||||||||||||||||||
Sbjct: 95945 aacacatatacttttctttt 95964



to top

>emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chromosome 9; segment 1/5
          Length = 330050

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 204    gtacataaaataaaatcatt 223
              ||||||||||||||||||||
Sbjct: 308186 gtacataaaataaaatcatt 308205



to top

>emb|AL161592.2|ATCHRIV88 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 88
          Length = 198493

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   cttatttatccaacatcatc 150
             ||||||||||||||||||||
Sbjct: 14098 cttatttatccaacatcatc 14117



to top

>emb|AL035709.1|ATT28I19 Arabidopsis thaliana DNA chromosome 4, BAC clone T28I19 (ESSA project)
          Length = 110766

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   cttatttatccaacatcatc 150
             ||||||||||||||||||||
Sbjct: 10396 cttatttatccaacatcatc 10415



to top

>emb|CR388046.14| Zebrafish DNA sequence from clone DKEY-50E6 in linkage group 7, complete
              sequence
          Length = 211210

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     tttgaaatgtacagtacata 61
              ||||||||||||||||||||
Sbjct: 176953 tttgaaatgtacagtacata 176972



to top

>gb|AC027449.6| Homo sapiens chromosome 18, clone RP11-535A5, complete sequence
          Length = 149660

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    ttttgaaatgtacagtacat 60
             ||||||||||||||||||||
Sbjct: 36206 ttttgaaatgtacagtacat 36187



to top

>gb|AC022825.9| Homo sapiens chromosome 8, clone RP11-88J22, complete sequence
          Length = 191772

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     aatgtacagtacatatactt 66
              ||||||||||||||||||||
Sbjct: 171027 aatgtacagtacatatactt 171008



to top

>gb|AC135795.21| Medicago truncatula clone mth2-28g10, complete sequence
          Length = 110937

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 47    aatgtacagtacatatacttatta 70
             ||||||||||||||||| ||||||
Sbjct: 22690 aatgtacagtacatatagttatta 22713



to top

>gb|AC154607.2| Mus musculus BAC clone RP23-331D17 from chromosome 16, complete sequence
          Length = 202496

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 206    acataaaataaaatcattaa 225
              ||||||||||||||||||||
Sbjct: 186066 acataaaataaaatcattaa 186047



to top

>gb|AC093560.2| Homo sapiens chromosome 1 clone RP11-398H19, complete sequence
          Length = 199594

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 40     cttttgaaatgtacagtaca 59
              ||||||||||||||||||||
Sbjct: 183485 cttttgaaatgtacagtaca 183504



to top

>gb|AC023170.10| Homo sapiens chromosome 10 clone RP11-373P23, complete sequence
          Length = 195448

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    ttttgaaatgtacagtacat 60
             ||||||||||||||||||||
Sbjct: 43439 ttttgaaatgtacagtacat 43458



to top

>gb|AC073569.26| Homo sapiens 12 BAC RP11-530C5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 177734

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    aacacatatacttttctttt 44
             ||||||||||||||||||||
Sbjct: 43842 aacacatatacttttctttt 43861



to top

>gb|AC093677.4| Homo sapiens BAC clone RP11-629B11 from 4, complete sequence
          Length = 148179

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   agttgtacataaaataaaat 219
             ||||||||||||||||||||
Sbjct: 72021 agttgtacataaaataaaat 72040



to top

>gb|AC022360.23| Homo sapiens 8 BAC RP11-58O3 (Roswell Park Cancer Institute Human BAC
            Library) complete sequence
          Length = 171991

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 41   ttttgaaatgtacagtacat 60
            ||||||||||||||||||||
Sbjct: 9642 ttttgaaatgtacagtacat 9661



to top

>gb|AC150889.3| Medicago truncatula chromosome 7 BAC clone mte1-61j12, complete
            sequence
          Length = 116517

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 47   aatgtacagtacatatacttatta 70
            ||||||||||||||||| ||||||
Sbjct: 1473 aatgtacagtacatatagttatta 1450



to top

>emb|BX296537.10| Zebrafish DNA sequence from clone CH211-249G3 in linkage group 2,
             complete sequence
          Length = 153636

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 43    ttgaaatgtacagtacatat 62
             ||||||||||||||||||||
Sbjct: 78948 ttgaaatgtacagtacatat 78929



to top

>tpg|BK000438.1| TPA: TPA_exp: Homo sapiens RING finger protein COP1 gene, complete cds
          Length = 421987

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     aatgtacagtacatatactt 66
              ||||||||||||||||||||
Sbjct: 253361 aatgtacagtacatatactt 253342



to top

>gb|AC084277.3| Homo sapiens BAC clone RP11-68O1 from 4, complete sequence
          Length = 150705

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 199    tagttgtacataaaataaaa 218
              ||||||||||||||||||||
Sbjct: 133808 tagttgtacataaaataaaa 133789



to top

>gb|AC051630.4|AC051630 Arabidopsis thaliana chromosome 1 BAC F10C21 genomic sequence, complete
             sequence
          Length = 97242

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   tcttatagttgtacataaaa 213
             ||||||||||||||||||||
Sbjct: 71034 tcttatagttgtacataaaa 71015



to top

>gb|AC018682.4| Homo sapiens BAC clone RP11-417F21 from 2, complete sequence
          Length = 181405

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   acataaaataaaatcattaa 225
             ||||||||||||||||||||
Sbjct: 70326 acataaaataaaatcattaa 70345



to top

>gb|AC066690.6|AC066690 Arabidopsis thaliana chromosome 1 BAC F3A14 genomic sequence, complete
             sequence
          Length = 24146

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    aacacatatacttttctttt 44
             ||||||||||||||||||||
Sbjct: 22162 aacacatatacttttctttt 22143



to top

>gb|AC069556.4|AC069556 Genomic Sequence For Arabidopsis thaliana Clone T1G16 From Chromosome
             V, complete sequence
          Length = 93672

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    aacacatatacttttctttt 44
             ||||||||||||||||||||
Sbjct: 29561 aacacatatacttttctttt 29580



to top

>gb|AC020646.2|AC020646 Genomic sequence for Arabidopsis thaliana BAC T32E20 from chromosome
            I, complete sequence
          Length = 103931

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   aacacatatacttttctttt 44
            ||||||||||||||||||||
Sbjct: 7746 aacacatatacttttctttt 7727



to top

>gb|AC007505.4|AC007505 Arabidopsis thaliana chromosome I BAC F28L22 genomic sequence, complete
              sequence
          Length = 134499

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     aacacatatacttttctttt 44
              ||||||||||||||||||||
Sbjct: 120128 aacacatatacttttctttt 120109



to top

>emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in linkage group 8,
             complete sequence
          Length = 163766

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 31    tatacttttcttttgaaatg 50
             ||||||||||||||||||||
Sbjct: 75490 tatacttttcttttgaaatg 75509



to top

>emb|AL355101.2|CNS05TCK Human chromosome 14 DNA sequence BAC R-686H21 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 164380

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     acaacccaaaccataatata 20
             ||||||||||||||||||||
Sbjct: 55461 acaacccaaaccataatata 55480



to top

>gb|AC167700.2| Reniera sp. JGI-2005 clone JGIBAYC-5J13, complete sequence
          Length = 39670

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 200   agttgtacataaaataaaatcatt 223
             ||||| ||||||||||||||||||
Sbjct: 35446 agttgaacataaaataaaatcatt 35469



to top

>emb|AL590723.13| Human DNA sequence from clone RP11-492I21 on chromosome 1 Contains part
             of the gene for constitutive photomorphogenic protein
             (COP1) and a novel gene, complete sequence
          Length = 178223

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    aatgtacagtacatatactt 66
             ||||||||||||||||||||
Sbjct: 89209 aatgtacagtacatatactt 89228



to top

>emb|AL035605.1|ATF19F18 Arabidopsis thaliana DNA chromosome 4, BAC clone  F19F18 (ESSA project)
          Length = 91740

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   cttatttatccaacatcatc 150
             ||||||||||||||||||||
Sbjct: 82015 cttatttatccaacatcatc 82034



to top

>gb|AC135019.3| Mus musculus BAC clone RP23-186D15 from 10, complete sequence
          Length = 189457

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   acataaaataaaatcattaa 225
             ||||||||||||||||||||
Sbjct: 69140 acataaaataaaatcattaa 69159



to top

>emb|AL672307.9| Mouse DNA sequence from clone RP23-141N2 on chromosome 2, complete
              sequence
          Length = 206168

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    acataaaataaaatcattaa 225
              ||||||||||||||||||||
Sbjct: 103000 acataaaataaaatcattaa 103019



to top

>emb|AL596246.10| Mouse DNA sequence from clone RP23-186E14 on chromosome 11, complete
             sequence
          Length = 144136

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    ttttgaaatgtacagtacat 60
             ||||||||||||||||||||
Sbjct: 36108 ttttgaaatgtacagtacat 36089



to top

>gb|AY035396.1| Escherichia coli O91 O-antigen gene cluster, complete sequence
          Length = 10196

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 59   atatacttattattacaacg 78
            ||||||||||||||||||||
Sbjct: 1272 atatacttattattacaacg 1291



to top

>dbj|AB030580.1| Homo sapiens DNA, breakpoint of inv(11)(q13,q25), cosmid clone CL1005
          Length = 30037

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 41   ttttgaaatgtacagtacat 60
            ||||||||||||||||||||
Sbjct: 6174 ttttgaaatgtacagtacat 6155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,826,048
Number of Sequences: 3902068
Number of extensions: 5826048
Number of successful extensions: 111455
Number of sequences better than 10.0: 65
Number of HSP's better than 10.0 without gapping: 65
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 111288
Number of HSP's gapped (non-prelim): 167
length of query: 407
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 385
effective length of database: 17,147,199,772
effective search space: 6601671912220
effective search space used: 6601671912220
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top