ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart53b02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK119438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 5e-28
2dbj|AK060623.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 5e-28
3dbj|AB021666.2| Oryza sativa (japonica cultivar-group) OsFEN-1a ... 133 5e-28
4dbj|AK103819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 1e-25
5ref|XM_475800.1| Oryza sativa (japonica cultivar-group), predic... 103 4e-19
6gb|AY104316.1| Zea mays PCO066214 mRNA sequence 101 2e-18
7ref|NM_180546.2| Arabidopsis thaliana 5'-3' exonuclease/ DNA bin... 72 2e-09
8gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome... 60 6e-06
9gb|AC119291.5| Oryza sativa (japonica cultivar-group) chromosome... 60 6e-06
10dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 60 6e-06
11dbj|AP005139.2| Homo sapiens genomic DNA, chromosome 18p clone:R... 44 0.35
12gb|AC155728.13| Mus musculus 6 BAC RP24-162H1 (Roswell Park Canc... 42 1.4
13emb|AL590440.1| Human DNA sequence from clone RP11-12C17 on chro... 42 1.4
14emb|CR354750.1| Mus musculus chromosome 6, clone tr151 strain 12... 42 1.4
15gb|AF044331.1|AF044331 Oncorhynchus sp. ribonuclease P RNA gene,... 42 1.4
16gb|U50384.1|MMU50384 Mus musculus retinoic acid-responsive (NN8-... 42 1.4
17gb|AC125448.16| Mus musculus chromosome 10, clone RP23-122D10, c... 40 5.4
18gb|AC146709.11| Medicago truncatula clone mth2-90m14, complete s... 40 5.4
19emb|AL357374.11| Human DNA sequence from clone RP11-353C18 on ch... 40 5.4
20emb|AL138966.19| Human DNA sequence from clone RP11-380N8 on chr... 40 5.4
21emb|AL118525.17|HSBA298O6 Human DNA sequence from clone RP11-298... 40 5.4
22emb|AL133324.13| Human DNA sequence from clone RP5-1161H23 on ch... 40 5.4
23gb|DQ124087.1| Coffea arabica clone MN-SSH3-D11 mRNA sequence 40 5.4
24emb|CR860215.1| Pongo pygmaeus mRNA; cDNA DKFZp469A1019 (from cl... 40 5.4
25gb|AC027319.5| Homo sapiens chromosome 19 clone CTC-518P12, comp... 40 5.4
26gb|DQ074975.1| Homo sapiens glutathione synthetase (GSS) gene, c... 40 5.4
27gb|AF058914.1|F21E10 Arabidopsis thaliana BAC F21E10, complete s... 40 5.4
28gb|AC102009.20| Mus musculus chromosome 10, clone RP24-512D20, c... 40 5.4
29gb|AC164160.5| Mus musculus BAC clone RP23-343P15 from chromosom... 40 5.4
30emb|AL353998.5|HS35M08 Homo sapiens chromosome 19 from PAC RPCI-... 40 5.4
31emb|AL669966.10| Mouse DNA sequence from clone RP23-174K9 on chr... 40 5.4

>dbj|AK119438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-133-B04, full
           insert sequence
          Length = 2579

 Score =  133 bits (67), Expect = 5e-28
 Identities = 139/163 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 tggtttctctgaagtttccttccgcttcagtggcactgatgtgctaacagttggcttgaa 304
           |||||| |||||||| ||||| |  ||||| ||||||||||||||||||  |||||||||
Sbjct: 644 tggtttttctgaagtgtcctttcttttcagaggcactgatgtgctaacaactggcttgaa 585

                                                                       
Query: 305 aaatgactcaagccttccttgggatgatttattctttgccgatttaatcttctctatggc 364
            || || || |||||||||||||| ||||| ||||| ||  |||||||||||||||||||
Sbjct: 584 gaaggattcgagccttccttgggaagatttgttcttggcaaatttaatcttctctatggc 525

                                                      
Query: 365 cttagtcacacgatcttgactgaagccgttttctttcaccaga 407
           ||| ||||| | ||||||  |||| || |||||||||||||||
Sbjct: 524 ctttgtcactctatcttggttgaaaccattttctttcaccaga 482



to top

>dbj|AK060623.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-F07, full
            insert sequence
          Length = 1406

 Score =  133 bits (67), Expect = 5e-28
 Identities = 139/163 (85%)
 Strand = Plus / Minus

                                                                        
Query: 245  tggtttctctgaagtttccttccgcttcagtggcactgatgtgctaacagttggcttgaa 304
            |||||| |||||||| ||||| |  ||||| ||||||||||||||||||  |||||||||
Sbjct: 1203 tggtttttctgaagtgtcctttcttttcagaggcactgatgtgctaacaactggcttgaa 1144

                                                                        
Query: 305  aaatgactcaagccttccttgggatgatttattctttgccgatttaatcttctctatggc 364
             || || || |||||||||||||| ||||| ||||| ||  |||||||||||||||||||
Sbjct: 1143 gaaggattcgagccttccttgggaagatttgttcttggcaaatttaatcttctctatggc 1084

                                                       
Query: 365  cttagtcacacgatcttgactgaagccgttttctttcaccaga 407
            ||| ||||| | ||||||  |||| || |||||||||||||||
Sbjct: 1083 ctttgtcactctatcttggttgaaaccattttctttcaccaga 1041



to top

>dbj|AB021666.2| Oryza sativa (japonica cultivar-group) OsFEN-1a mRNA for FEN-1,
            complete cds
          Length = 1354

 Score =  133 bits (67), Expect = 5e-28
 Identities = 139/163 (85%)
 Strand = Plus / Minus

                                                                        
Query: 245  tggtttctctgaagtttccttccgcttcagtggcactgatgtgctaacagttggcttgaa 304
            |||||| |||||||| ||||| |  ||||| ||||||||||||||||||  |||||||||
Sbjct: 1155 tggtttttctgaagtgtcctttcttttcagaggcactgatgtgctaacaactggcttgaa 1096

                                                                        
Query: 305  aaatgactcaagccttccttgggatgatttattctttgccgatttaatcttctctatggc 364
             || || || |||||||||||||| ||||| ||||| ||  |||||||||||||||||||
Sbjct: 1095 gaaggattcgagccttccttgggaagatttgttcttggcaaatttaatcttctctatggc 1036

                                                       
Query: 365  cttagtcacacgatcttgactgaagccgttttctttcaccaga 407
            ||| ||||| | ||||||  |||| || |||||||||||||||
Sbjct: 1035 ctttgtcactctatcttggttgaaaccattttctttcaccaga 993



to top

>dbj|AK103819.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147G19, full
            insert sequence
          Length = 1481

 Score =  125 bits (63), Expect = 1e-25
 Identities = 139/163 (85%), Gaps = 1/163 (0%)
 Strand = Plus / Minus

                                                                        
Query: 245  tggtttctctgaagtttccttccgcttcagtggcactgatgtgctaacagttggcttgaa 304
            |||||| |||||||| ||||| |  ||||| ||||||||||||||||||  |||||||||
Sbjct: 1165 tggtttttctgaagtgtcctttcttttcagaggcactgatgtgctaacaactggcttgaa 1106

                                                                        
Query: 305  aaatgactcaagccttccttgggatgatttattctttgccgatttaatcttctctatggc 364
             || || || |||||||||||||| ||||| ||| ||||  |||||||||||||||||||
Sbjct: 1105 gaaggattcgagccttccttgggaagatttgttc-ttgcaaatttaatcttctctatggc 1047

                                                       
Query: 365  cttagtcacacgatcttgactgaagccgttttctttcaccaga 407
            ||| ||||| | ||||||  |||| || |||||||||||||||
Sbjct: 1046 ctttgtcactctatcttggttgaaaccattttctttcaccaga 1004



to top

>ref|XM_475800.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1143

 Score =  103 bits (52), Expect = 4e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                        
Query: 245  tggtttctctgaagtttccttccgcttcagtggcactgatgtgctaacagttggcttgaa 304
            |||||| |||||||| ||||| |  ||||| ||||||||||||||||||  |||||||||
Sbjct: 1089 tggtttttctgaagtgtcctttcttttcagaggcactgatgtgctaacaactggcttgaa 1030

                                                                        
Query: 305  aaatgactcaagccttccttgggatgatttattctttgccgatttaatcttctctatggc 364
             || || || |||||||||||||| ||||| ||||| ||  |||||||||||||||||||
Sbjct: 1029 gaaggattcgagccttccttgggaagatttgttcttggcaaatttaatcttctctatggc 970



to top

>gb|AY104316.1| Zea mays PCO066214 mRNA sequence
          Length = 1552

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                        
Query: 255  gaagtttccttccgcttcagtggcactgatgtgctaacagttggcttgaaaaatgactca 314
            ||||| |||||||| || || ||  |||||||| |  |||||||||||||||| ||||| 
Sbjct: 1168 gaagtctccttccgttttagcggtgctgatgtggtggcagttggcttgaaaaaggactcg 1109

                                                                        
Query: 315  agccttccttgggatgatttattctttgccgatttaatcttctctatggccttagtcaca 374
            || |||||||| || ||||||||||| || ||||| ||||||||||||||||| ||||| 
Sbjct: 1108 agtcttccttgcgacgatttattcttggcagatttgatcttctctatggcctttgtcacc 1049

                   
Query: 375  cgatctt 381
            |||||||
Sbjct: 1048 cgatctt 1042



to top

>ref|NM_180546.2| Arabidopsis thaliana 5'-3' exonuclease/ DNA binding / nuclease
            AT5G26680 mRNA, complete cds
          Length = 1379

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                        
Query: 296  tggcttgaaaaatgactcaagccttccttgggatgatttattctttgccgatttaatctt 355
            |||||||||||||||||| ||||| || || |||||||||||||| || | |||||| ||
Sbjct: 1061 tggcttgaaaaatgactccagcctgccctgcgatgatttattcttcgcagttttaatttt 1002

                        
Query: 356  ctctatggcctt 367
            |||||| |||||
Sbjct: 1001 ctctatcgcctt 990



to top

>gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11,
            complete sequence
          Length = 115808

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 317  ccttccttgggatgatttattctttgccgatttaatcttctctatggcct 366
            |||||||||||| ||||| ||||| ||  |||||||||||||||||||||
Sbjct: 5368 ccttccttgggaagatttgttcttggcaaatttaatcttctctatggcct 5417



 Score = 46.1 bits (23), Expect = 0.088
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 270  ttcagtggcactgatgtgctaacagttggcttgaa 304
            ||||| ||||||||||||||||||  |||||||||
Sbjct: 5217 ttcagaggcactgatgtgctaacaactggcttgaa 5251



to top

>gb|AC119291.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052K01,
              complete sequence
          Length = 144395

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 317    ccttccttgggatgatttattctttgccgatttaatcttctctatggcct 366
              |||||||||||| ||||| ||||| ||  |||||||||||||||||||||
Sbjct: 137846 ccttccttgggaagatttgttcttggcaaatttaatcttctctatggcct 137895



 Score = 46.1 bits (23), Expect = 0.088
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 270    ttcagtggcactgatgtgctaacagttggcttgaa 304
              ||||| ||||||||||||||||||  |||||||||
Sbjct: 137695 ttcagaggcactgatgtgctaacaactggcttgaa 137729



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                  
Query: 317      ccttccttgggatgatttattctttgccgatttaatcttctctatggcct 366
                |||||||||||| ||||| ||||| ||  |||||||||||||||||||||
Sbjct: 26624371 ccttccttgggaagatttgttcttggcaaatttaatcttctctatggcct 26624420



 Score = 46.1 bits (23), Expect = 0.088
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                   
Query: 270      ttcagtggcactgatgtgctaacagttggcttgaa 304
                ||||| ||||||||||||||||||  |||||||||
Sbjct: 26624220 ttcagaggcactgatgtgctaacaactggcttgaa 26624254



to top

>dbj|AP005139.2| Homo sapiens genomic DNA, chromosome 18p clone:RP11-93H10, complete
              sequences
          Length = 165500

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 152    aactgaggatgccactgcagcttttg 177
              ||||||||||||||||||||| ||||
Sbjct: 103950 aactgaggatgccactgcagcatttg 103925



to top

>gb|AC155728.13| Mus musculus 6 BAC RP24-162H1 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 176377

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 106    aacaccgaacaaagtttttag 126
              |||||||||||||||||||||
Sbjct: 125239 aacaccgaacaaagtttttag 125219



to top

>emb|AL590440.1| Human DNA sequence from clone RP11-12C17 on chromosome 1 Contains the
             5' end of the gene for barttin (BSND), a novel gene
             (LOC199964), a novel gene and a CpG island, complete
             sequence
          Length = 63011

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 99    acaagagaacaccgaacaaag 119
             |||||||||||||||||||||
Sbjct: 18630 acaagagaacaccgaacaaag 18610



to top

>emb|CR354750.1| Mus musculus chromosome 6, clone tr151 strain 129/Sv, complete sequence
          Length = 167508

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 106    aacaccgaacaaagtttttag 126
              |||||||||||||||||||||
Sbjct: 112269 aacaccgaacaaagtttttag 112249



to top

>gb|AF044331.1|AF044331 Oncorhynchus sp. ribonuclease P RNA gene, partial sequence
          Length = 308

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 233 agctgcactggctggtttctc 253
           |||||||||||||||||||||
Sbjct: 185 agctgcactggctggtttctc 165



to top

>gb|U50384.1|MMU50384 Mus musculus retinoic acid-responsive (NN8-4AG) gene, partial cds
          Length = 1131

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 106 aacaccgaacaaagtttttag 126
           |||||||||||||||||||||
Sbjct: 268 aacaccgaacaaagtttttag 248



to top

>gb|AC125448.16| Mus musculus chromosome 10, clone RP23-122D10, complete sequence
          Length = 188948

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   ctttgccgatttaatcttct 357
             ||||||||||||||||||||
Sbjct: 25734 ctttgccgatttaatcttct 25715



to top

>gb|AC146709.11| Medicago truncatula clone mth2-90m14, complete sequence
          Length = 110472

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    caagtcactaatttacctaa 81
             ||||||||||||||||||||
Sbjct: 35217 caagtcactaatttacctaa 35236



to top

>emb|AL357374.11| Human DNA sequence from clone RP11-353C18 on chromosome 20 Contains the
             5' end of the NFS1 gene for nitrogen fixation 1 (S.
             cerevisiae), the C20orf52 gene, the RNPC2 gene for
             RNA-binding region (RNP1, RRM) containing 2, a BXDC1
             pseudogene, the 5' end of the C20orf104 gene and three CpG
             islands, complete sequence
          Length = 80565

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    tgagacagagtttcgttttt 53
             ||||||||||||||||||||
Sbjct: 44613 tgagacagagtttcgttttt 44594



to top

>emb|AL138966.19| Human DNA sequence from clone RP11-380N8 on chromosome 13 Contains the
              RNF6 gene for ring finger protein (C3H2C3 type) 6, a
              protein-kinase, interferon-inducible double stranded RNA
              dependent inhibitor, repressor of (P58 repressor)(inhibitor
              of protein kinase PKR) (PRKRIR) pseudogene, a TcD37 homolog
              (HTCD37) pseudogene, a  pseudogene similar to part of
              ATPase, aminophospholipid transporter (APLT), Class I, type
              8A, member 1 (ATPase II aminophospholipid translocase)
              (ATP8A1)(ATPIA, ATPP2, ATPASEII) and 2 CpG islands,
              complete sequence
          Length = 171160

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     tgagacagagtttcgttttt 53
              ||||||||||||||||||||
Sbjct: 161150 tgagacagagtttcgttttt 161131



to top

>emb|AL118525.17|HSBA298O6 Human DNA sequence from clone RP11-298O6 on chromosome 20 Contains the
             PTGIS gene for prostaglandin I2 (prostacyclin) synthase,
             ESTs, STSs, GSSs and a CpG Island, complete sequence
          Length = 103747

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    tgagacagagtttcgttttt 53
             ||||||||||||||||||||
Sbjct: 41898 tgagacagagtttcgttttt 41879



to top

>emb|AL133324.13| Human DNA sequence from clone RP5-1161H23 on chromosome 20 Contains the
             3' end of the ACAS2 gene for acetyl-Coenzyme A synthetase
             2 (ADP forming), the GSS (glutathione synthetase) gene,
             the 5' end of the MYH7B gene for myosin heavy polypeptide
             7B (cardiac muscle) beta and a CpG island, complete
             sequence
          Length = 59102

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    tgagacagagtttcgttttt 53
             ||||||||||||||||||||
Sbjct: 18689 tgagacagagtttcgttttt 18670



to top

>gb|DQ124087.1| Coffea arabica clone MN-SSH3-D11 mRNA sequence
          Length = 325

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 385 tgaagccgttttctttcacc 404
           ||||||||||||||||||||
Sbjct: 284 tgaagccgttttctttcacc 265



to top

>emb|CR860215.1| Pongo pygmaeus mRNA; cDNA DKFZp469A1019 (from clone DKFZp469A1019)
          Length = 3043

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   tgagacagagtttcgttttt 53
            ||||||||||||||||||||
Sbjct: 3029 tgagacagagtttcgttttt 3010



to top

>gb|AC027319.5| Homo sapiens chromosome 19 clone CTC-518P12, complete sequence
          Length = 152033

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tgagacagagtttcgttttt 53
             ||||||||||||||||||||
Sbjct: 79820 tgagacagagtttcgttttt 79839



to top

>gb|DQ074975.1| Homo sapiens glutathione synthetase (GSS) gene, complete cds
          Length = 31011

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tgagacagagtttcgttttt 53
             ||||||||||||||||||||
Sbjct: 18247 tgagacagagtttcgttttt 18266



to top

>gb|AF058914.1|F21E10 Arabidopsis thaliana BAC F21E10, complete sequence
          Length = 111767

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 296   tggcttgaaaaatgactcaagcct 319
             |||||||||||||||||| |||||
Sbjct: 85879 tggcttgaaaaatgactccagcct 85856



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                     
Query: 327   gatgatttattctttgccgatttaatcttctctatggcct 366
             |||||||||||||| || | |||||| |||||||| ||||
Sbjct: 85767 gatgatttattcttcgcagttttaattttctctatcgcct 85728



to top

>gb|AC102009.20| Mus musculus chromosome 10, clone RP24-512D20, complete sequence
          Length = 172721

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   ctttgccgatttaatcttct 357
             ||||||||||||||||||||
Sbjct: 83445 ctttgccgatttaatcttct 83426



to top

>gb|AC164160.5| Mus musculus BAC clone RP23-343P15 from chromosome 7, complete sequence
          Length = 235030

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 346   atttaatcttctctatggccttag 369
             |||||||| |||||||||||||||
Sbjct: 95749 atttaatcctctctatggccttag 95772



to top

>emb|AL353998.5|HS35M08 Homo sapiens chromosome 19 from PAC RPCI-1 35M08, complete sequence
          Length = 99187

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tgagacagagtttcgttttt 53
             ||||||||||||||||||||
Sbjct: 66124 tgagacagagtttcgttttt 66143



to top

>emb|AL669966.10| Mouse DNA sequence from clone RP23-174K9 on chromosome 4, complete
             sequence
          Length = 199890

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 296   tggcttgaaaaatgactcaa 315
             ||||||||||||||||||||
Sbjct: 18991 tggcttgaaaaatgactcaa 19010


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,400,200
Number of Sequences: 3902068
Number of extensions: 4400200
Number of successful extensions: 102774
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 102677
Number of HSP's gapped (non-prelim): 96
length of query: 407
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 385
effective length of database: 17,147,199,772
effective search space: 6601671912220
effective search space used: 6601671912220
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top