ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart53a08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC009720.19| Homo sapiens chromosome 17, clone RP11-1094H24, ... 48 0.015
2emb|AL732496.2| Mouse DNA sequence from clone RP23-35G10 on chro... 48 0.015
3gb|AC166993.4| Mus musculus BAC clone RP23-467D18 from chromosom... 46 0.058
4gb|AC128738.4| Mus musculus BAC clone RP24-106M4 from chromosome... 46 0.058
5gb|AC165082.2| Mus musculus BAC clone RP23-412H17 from chromosom... 46 0.058
6gb|AC138678.24| Mus musculus chromosome 7, clone RP23-18B20, com... 46 0.058
7gb|AC147232.4| Mus musculus BAC clone RP23-311C15 from 7, comple... 46 0.058
8gb|AC116758.11| Mus musculus chromosome 8, clone RP23-383A10, co... 44 0.23
9gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, com... 44 0.23
10gb|AC101991.9| Mus musculus chromosome 1, clone RP24-372E16, com... 44 0.23
11gb|AC116781.9| Mus musculus chromosome 16, clone RP24-134G20, co... 44 0.23
12gb|AC101672.11| Mus musculus chromosome 5, clone RP23-115F16, co... 44 0.23
13gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, compl... 44 0.23
14gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, co... 44 0.23
15gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosom... 44 0.23
16gb|AC129289.4| Mus musculus BAC clone RP24-482E11 from chromosom... 44 0.23
17gb|AC128670.3| Mus musculus BAC clone RP23-137H4 from chromosome... 44 0.23
18gb|AC145299.3| Mus musculus BAC clone RP24-129J23 from chromosom... 44 0.23
19gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosom... 44 0.23
20gb|AC140781.3| Mus musculus BAC clone RP24-497M1 from chromosome... 44 0.23
21gb|AC140469.2| Mus musculus BAC clone RP24-396D20 from chromosom... 44 0.23
22gb|AC122410.4| Mus musculus BAC clone RP24-142A1 from chromosome... 44 0.23
23gb|AC132452.3| Mus musculus BAC clone RP23-195K10 from chromosom... 44 0.23
24gb|AC129202.3| Mus musculus BAC clone RP24-225J1 from chromosome... 44 0.23
25gb|AC126678.3| Mus musculus BAC clone RP24-231D7 from chromosome... 44 0.23
26gb|AC112990.7| Mus musculus chromosome 19, clone RP24-317E20, co... 44 0.23
27gb|AC101994.3| Mus musculus chromosome 1, clone RP24-406F14, com... 44 0.23
28gb|AC112342.14| Rattus norvegicus 14 BAC CH230-253H12 (Children'... 44 0.23
29gb|AC091783.9| Genomic sequence for Mus musculus, clone RP23-16G... 44 0.23
30gb|AC162868.2| Mus musculus chromosome 1, clone RP24-296M22, com... 44 0.23
31gb|AC008798.10| Homo sapiens chromosome 19 clone CTD-2057D4, com... 44 0.23
32gb|AC009260.13| Homo sapiens 12 BAC RP11-435A10 (Roswell Park Ca... 44 0.23
33gb|AC073866.16| Homo sapiens 12q BAC RP11-120B18 (Roswell Park C... 44 0.23
34gb|AC177797.3| Mus musculus BAC clone RP24-558G11 from chromosom... 44 0.23
35emb|BX005216.10| Zebrafish DNA sequence from clone CH211-286O21,... 44 0.23
36gb|AC154542.2| Mus musculus BAC clone RP23-458O22 from chromosom... 44 0.23
37emb|AL831780.12| Mouse DNA sequence from clone RP23-394B8 on chr... 44 0.23
38emb|AL929559.12| Zebrafish DNA sequence from clone CH211-106G5 i... 44 0.23
39gb|AC154829.2| Mus musculus BAC clone RP24-550F10 from 14, compl... 44 0.23
40emb|BX004874.11| Zebrafish DNA sequence from clone CH211-39E15 i... 44 0.23
41gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosom... 44 0.23
42dbj|AP000439.6| Homo sapiens genomic DNA, chromosome 11 clone:CM... 44 0.23
43gb|AC117796.12| Mus musculus chromosome 1, clone RP24-554P6, com... 44 0.23
44dbj|AP003965.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 44 0.23
45emb|AL831763.6| Mouse DNA sequence from clone RP23-308A23 on chr... 44 0.23
46gb|AC133576.10| Mus musculus chromosome 19, clone RP23-204H15, c... 44 0.23
47emb|CR956397.19| Pig DNA sequence from clone CH242-259E5 on chro... 44 0.23
48gb|AC145597.4| Mus musculus BAC clone RP24-323M2 from Y, complet... 44 0.23
49gb|AC147639.3| Mus musculus BAC clone RP23-115M6 from 13, comple... 44 0.23
50emb|AL672244.15| Mouse DNA sequence from clone RP23-43I8 on chro... 44 0.23
51emb|AL672051.14| Mouse DNA sequence from clone RP23-332O3 on chr... 44 0.23
52gb|AC002070.1|HSAC002070 Human BAC clone 7E17 from 12q, complete... 44 0.23
53dbj|AP005233.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 44 0.23
54emb|AL607087.10| Mouse DNA sequence from clone RP23-18M1 on chro... 44 0.23
55emb|AL606974.9| Mouse DNA sequence from clone RP23-39E21 on chro... 44 0.23
56gb|AC121834.4| Mus musculus BAC clone RP24-72F20 from chromosome... 44 0.23
57gb|AC114494.2| Homo sapiens chromosome 1 clone RP11-439L8, compl... 44 0.23
58gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, co... 42 0.90
59gb|AY372121.1| Plasmodium falciparum Dd2_var6 erythrocyte membra... 42 0.90
60gb|AC130721.3| Mus musculus BAC clone RP24-333B3 from chromosome... 42 0.90
61gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 ma... 42 0.90
62emb|BX649501.24| Zebrafish DNA sequence from clone DKEY-123F20 i... 42 0.90
63gb|AC126615.7| Homo sapiens 12 BAC RP11-129B9 (Roswell Park Canc... 42 0.90
64gb|AC149089.4| Mus musculus BAC clone RP23-94H23 from 6, complet... 42 0.90
65dbj|AP002004.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 0.90
66gb|AC110509.21| Mus musculus chromosome 8, clone RP24-423G4, com... 40 3.6
67gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section ... 40 3.6
68gb|AC003057.1| Mouse Cosmid ma08m030 from 14D1-D2, complete sequ... 40 3.6
69gb|AC115013.18| Mus musculus chromosome 10, clone RP24-193P19, c... 40 3.6
70gb|BC068929.1| Xenopus laevis hypothetical protein LOC414705, mR... 40 3.6
71gb|U39740.1| Caenorhabditis elegans cosmid ZC64, complete sequence 40 3.6
72gb|AC158549.8| Mus musculus chromosome 19, clone RP24-216K4, com... 40 3.6
73gb|AC139223.8| Mus musculus chromosome 8, clone RP24-322F24, com... 40 3.6
74emb|BX957236.8| Zebrafish DNA sequence from clone DKEY-178O3 in ... 40 3.6
75gb|AC010927.5|ATAC010927 Arabidopsis thaliana chromosome III BAC... 40 3.6
76emb|CR388035.9| Zebrafish DNA sequence from clone DKEY-104O19, c... 40 3.6
77emb|AL672152.8| Mouse DNA sequence from clone RP23-426A16 on chr... 40 3.6
78emb|BX927186.21| Zebrafish DNA sequence from clone DKEY-29H4 in ... 40 3.6
79emb|AL391497.9| Human DNA sequence from clone RP11-302M6 on chro... 40 3.6
80emb|BX883042.1| Rattus norvegicus chromosome 20, major histocomp... 40 3.6
81emb|BX537277.15| Zebrafish DNA sequence from clone DKEY-45D16 in... 40 3.6
82gb|AC120387.5| Mus musculus chromosome 8, clone RP24-299O22, com... 40 3.6
83emb|BX908743.5| Zebrafish DNA sequence from clone RP71-3H8 in li... 40 3.6
84emb|AJ632304.1| Cotesia congregata virus complete genome, segmen... 40 3.6
85gb|AC120734.5| Rattus norvegicus BAC CH230-220D1 (Children's Ho... 40 3.6
86gb|AC149225.18| Danio rerio clone ch211-103f17, complete sequence 40 3.6
87gb|AC010701.3| Drosophila melanogaster 3L BAC RP98-26P10 (Roswel... 40 3.6
88emb|BX908736.10| Zebrafish DNA sequence from clone CH211-229C8 i... 40 3.6
89gb|DP000005.1| Macaca mulatta target 1 genomic scaffold 40 3.6
90gb|AE008686.1|AE008686 Mus musculus T-cell receptor alpha/delta ... 40 3.6
91gb|AY167135.1| Drosophila willistoni RPS18 gene, partial cds; PL... 40 3.6
92gb|AF284354.1|AF284354 Acanthopagrus butcheri clone 2A5 microsat... 40 3.6
93gb|AC000067.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 100h... 40 3.6
94dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.6
95gb|AC154285.2| Mus musculus BAC clone RP23-452P8 from chromosome... 40 3.6
96gb|AC130184.4| Macaca mulatta clone CH250-513J21, complete sequence 40 3.6
97gb|AC128714.15| Homo sapiens 3 BAC RP11-433C9 (Roswell Park Canc... 40 3.6
98dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.6
99dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic D... 40 3.6
100emb|AL935114.8| Zebrafish DNA sequence from clone CH211-182P11, ... 40 3.6
101emb|BX004769.9| Zebrafish DNA sequence from clone DKEY-15I8 in l... 40 3.6
102emb|BX323086.4| Zebrafish DNA sequence from clone DKEY-170I11 in... 40 3.6
103emb|AL935117.16| Zebrafish DNA sequence from clone CH211-197G22 ... 40 3.6
104gb|AE003595.3| Drosophila melanogaster chromosome 3L, section 76... 40 3.6
105emb|AL163872.2|CNS05TBN Human chromosome 14 DNA sequence BAC R-7... 40 3.6
106emb|AL691448.24| Mouse DNA sequence from clone RP23-103A1 on chr... 40 3.6
107emb|AL928963.8| Mouse DNA sequence from clone RP23-5K9 on chromo... 40 3.6 
>gb|AC009720.19| Homo sapiens chromosome 17, clone RP11-1094H24, complete sequence
          Length = 146101

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 212   acatgcatccatgcatccatgcacgcaa 239
             ||||||||||||||||||||||| ||||
Sbjct: 35254 acatgcatccatgcatccatgcatgcaa 35227
to top
>emb|AL732496.2| Mouse DNA sequence from clone RP23-35G10 on chromosome 2, complete
             sequence
          Length = 132023

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 87    ttataaacatttttattcctaaat 110
             ||||||||||||||||||||||||
Sbjct: 22531 ttataaacatttttattcctaaat 22554
to top
>gb|AC166993.4| Mus musculus BAC clone RP23-467D18 from chromosome 17, complete sequence
          Length = 199776

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 213    catgcatccatgcatccatgcac 235
              |||||||||||||||||||||||
Sbjct: 103508 catgcatccatgcatccatgcac 103486



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 103616 catgcatccatgcatccatgca 103595



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 103516 catgcatccatgcatccatgca 103495



 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 213    catgcatccatgcatccatg 232
              ||||||||||||||||||||
Sbjct: 103608 catgcatccatgcatccatg 103589
to top
>gb|AC128738.4| Mus musculus BAC clone RP24-106M4 from chromosome 7, complete sequence
          Length = 148567

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 212   acatgcatccatgcatccatgca 234
             |||||||||||||||||||||||
Sbjct: 96398 acatgcatccatgcatccatgca 96376
to top
>gb|AC165082.2| Mus musculus BAC clone RP23-412H17 from chromosome 17, complete
            sequence
          Length = 196132

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 213  catgcatccatgcatccatgcac 235
            |||||||||||||||||||||||
Sbjct: 2714 catgcatccatgcatccatgcac 2736



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 213  catgcatccatgcatccatgca 234
            ||||||||||||||||||||||
Sbjct: 2706 catgcatccatgcatccatgca 2727



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 213  catgcatccatgcatccatgca 234
            ||||||||||||||||||||||
Sbjct: 2606 catgcatccatgcatccatgca 2627



 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 213  catgcatccatgcatccatg 232
            ||||||||||||||||||||
Sbjct: 2614 catgcatccatgcatccatg 2633
to top
>gb|AC138678.24| Mus musculus chromosome 7, clone RP23-18B20, complete sequence
          Length = 205257

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 212  acatgcatccatgcatccatgca 234
            |||||||||||||||||||||||
Sbjct: 8691 acatgcatccatgcatccatgca 8669
to top
>gb|AC147232.4| Mus musculus BAC clone RP23-311C15 from 7, complete sequence
          Length = 191521

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 212    acatgcatccatgcatccatgca 234
              |||||||||||||||||||||||
Sbjct: 145844 acatgcatccatgcatccatgca 145822
to top
>gb|AC116758.11| Mus musculus chromosome 8, clone RP23-383A10, complete sequence
          Length = 190294

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 90181 catgcatccatgcatccatgca 90160
to top
>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence
          Length = 186903

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 73274 catgcatccatgcatccatgca 73253
to top
>gb|AC101991.9| Mus musculus chromosome 1, clone RP24-372E16, complete sequence
          Length = 135000

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 132564 catgcatccatgcatccatgca 132543



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 132556 catgcatccatgcatccatgca 132535



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 132548 catgcatccatgcatccatgca 132527
to top
>gb|AC116781.9| Mus musculus chromosome 16, clone RP24-134G20, complete sequence
          Length = 166568

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 165540 catgcatccatgcatccatgca 165519



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 165532 catgcatccatgcatccatgca 165511



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 165524 catgcatccatgcatccatgca 165503
to top
>gb|AC101672.11| Mus musculus chromosome 5, clone RP23-115F16, complete sequence
          Length = 204025

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 164372 catgcatccatgcatccatgca 164351



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 164364 catgcatccatgcatccatgca 164343



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 164356 catgcatccatgcatccatgca 164335



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 164348 catgcatccatgcatccatgca 164327



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 164340 catgcatccatgcatccatgca 164319



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 164332 catgcatccatgcatccatgca 164311
to top
>gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, complete sequence
          Length = 179251

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 173970 catgcatccatgcatccatgca 173949



 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 213    catgcatccatgcatccatg 232
              ||||||||||||||||||||
Sbjct: 174138 catgcatccatgcatccatg 174119
to top
>gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, complete sequence
          Length = 152414

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 49167 catgcatccatgcatccatgca 49188
to top
>gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosome Y, complete sequence
          Length = 222176

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 79390 catgcatccatgcatccatgca 79369



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 79382 catgcatccatgcatccatgca 79361



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 79374 catgcatccatgcatccatgca 79353



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 79366 catgcatccatgcatccatgca 79345



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 79358 catgcatccatgcatccatgca 79337



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 79350 catgcatccatgcatccatgca 79329



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 79342 catgcatccatgcatccatgca 79321



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18429 catgcatccatgcatccatgca 18408



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18421 catgcatccatgcatccatgca 18400



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18413 catgcatccatgcatccatgca 18392



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18405 catgcatccatgcatccatgca 18384



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18397 catgcatccatgcatccatgca 18376



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18389 catgcatccatgcatccatgca 18368



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18381 catgcatccatgcatccatgca 18360



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18373 catgcatccatgcatccatgca 18352



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18365 catgcatccatgcatccatgca 18344



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18357 catgcatccatgcatccatgca 18336



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18349 catgcatccatgcatccatgca 18328



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 18341 catgcatccatgcatccatgca 18320
to top
>gb|AC129289.4| Mus musculus BAC clone RP24-482E11 from chromosome Y, complete sequence
          Length = 181755

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 16165 catgcatccatgcatccatgca 16144



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 16141 catgcatccatgcatccatgca 16120



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 16133 catgcatccatgcatccatgca 16112
to top
>gb|AC128670.3| Mus musculus BAC clone RP23-137H4 from chromosome 13, complete sequence
          Length = 173020

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 56099 catgcatccatgcatccatgca 56120



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 56091 catgcatccatgcatccatgca 56112



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 56083 catgcatccatgcatccatgca 56104
to top
>gb|AC145299.3| Mus musculus BAC clone RP24-129J23 from chromosome Y, complete sequence
          Length = 152085

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 100303 catgcatccatgcatccatgca 100324



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 100295 catgcatccatgcatccatgca 100316



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 100271 catgcatccatgcatccatgca 100292
to top
>gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosome Y, complete sequence
          Length = 170988

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 17262 catgcatccatgcatccatgca 17241



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 17254 catgcatccatgcatccatgca 17233



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 17246 catgcatccatgcatccatgca 17225



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 17238 catgcatccatgcatccatgca 17217



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 17230 catgcatccatgcatccatgca 17209



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 17222 catgcatccatgcatccatgca 17201



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 17214 catgcatccatgcatccatgca 17193
to top
>gb|AC140781.3| Mus musculus BAC clone RP24-497M1 from chromosome 19, complete sequence
          Length = 131111

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 116165 catgcatccatgcatccatgca 116144



 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    acatgcatccatgcatccat 231
              ||||||||||||||||||||
Sbjct: 116202 acatgcatccatgcatccat 116183
to top
>gb|AC140469.2| Mus musculus BAC clone RP24-396D20 from chromosome 19, complete
             sequence
          Length = 180376

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 28797 catgcatccatgcatccatgca 28776
to top
>gb|AC122410.4| Mus musculus BAC clone RP24-142A1 from chromosome 6, complete sequence
          Length = 190744

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 69650 catgcatccatgcatccatgca 69671
to top
>gb|AC132452.3| Mus musculus BAC clone RP23-195K10 from chromosome 19, complete sequence
          Length = 218688

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 206859 catgcatccatgcatccatgca 206838
to top
>gb|AC129202.3| Mus musculus BAC clone RP24-225J1 from chromosome 13, complete sequence
          Length = 168558

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 135317 catgcatccatgcatccatgca 135338
to top
>gb|AC126678.3| Mus musculus BAC clone RP24-231D7 from chromosome 13, complete
            sequence
          Length = 150512

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 213  catgcatccatgcatccatgca 234
            ||||||||||||||||||||||
Sbjct: 5785 catgcatccatgcatccatgca 5806
to top
>gb|AC112990.7| Mus musculus chromosome 19, clone RP24-317E20, complete sequence
          Length = 183322

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 80465 catgcatccatgcatccatgca 80444
to top
>gb|AC101994.3| Mus musculus chromosome 1, clone RP24-406F14, complete sequence
          Length = 164170

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 213 catgcatccatgcatccatgca 234
           ||||||||||||||||||||||
Sbjct: 334 catgcatccatgcatccatgca 313



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 213 catgcatccatgcatccatgca 234
           ||||||||||||||||||||||
Sbjct: 326 catgcatccatgcatccatgca 305



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 213 catgcatccatgcatccatgca 234
           ||||||||||||||||||||||
Sbjct: 318 catgcatccatgcatccatgca 297
to top
>gb|AC112342.14| Rattus norvegicus 14 BAC CH230-253H12 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 150292

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 23351 catgcatccatgcatccatgca 23330



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 23343 catgcatccatgcatccatgca 23322



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 213   catgcatccatgcatccatgcacgca 238
             ||||||||||||||||||| ||||||
Sbjct: 23012 catgcatccatgcatccatccacgca 22987



 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   catgcatccatgcatccatg 232
             ||||||||||||||||||||
Sbjct: 23295 catgcatccatgcatccatg 23276
to top
>gb|AC091783.9| Genomic sequence for Mus musculus, clone RP23-16G10, complete sequence
          Length = 228160

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 195581 catgcatccatgcatccatgca 195560



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 195573 catgcatccatgcatccatgca 195552



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 195565 catgcatccatgcatccatgca 195544



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 195557 catgcatccatgcatccatgca 195536



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 195549 catgcatccatgcatccatgca 195528



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 195541 catgcatccatgcatccatgca 195520
to top
>gb|AC162868.2| Mus musculus chromosome 1, clone RP24-296M22, complete sequence
          Length = 172586

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 213  catgcatccatgcatccatgca 234
            ||||||||||||||||||||||
Sbjct: 2453 catgcatccatgcatccatgca 2474



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 213  catgcatccatgcatccatgca 234
            ||||||||||||||||||||||
Sbjct: 2445 catgcatccatgcatccatgca 2466



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 213  catgcatccatgcatccatgca 234
            ||||||||||||||||||||||
Sbjct: 2437 catgcatccatgcatccatgca 2458
to top
>gb|AC008798.10| Homo sapiens chromosome 19 clone CTD-2057D4, complete sequence
          Length = 135331

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 116983 catgcatccatgcatccatgca 117004



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 116975 catgcatccatgcatccatgca 116996
to top
>gb|AC009260.13| Homo sapiens 12 BAC RP11-435A10 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 99727

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 50249 catgcatccatgcatccatgca 50228
to top
>gb|AC073866.16| Homo sapiens 12q BAC RP11-120B18 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 153756

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 27352 catgcatccatgcatccatgca 27373



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 27344 catgcatccatgcatccatgca 27365
to top
>gb|AC177797.3| Mus musculus BAC clone RP24-558G11 from chromosome y, complete sequence
          Length = 174066

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 152882 catgcatccatgcatccatgca 152861



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 152858 catgcatccatgcatccatgca 152837



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 152850 catgcatccatgcatccatgca 152829
to top
>emb|BX005216.10| Zebrafish DNA sequence from clone CH211-286O21, complete sequence
          Length = 163291

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 156564 catgcatccatgcatccatgca 156585
to top
>gb|AC154542.2| Mus musculus BAC clone RP23-458O22 from chromosome 17, complete
             sequence
          Length = 191836

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 64868 catgcatccatgcatccatgca 64847



 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 214   atgcatccatgcatccatgca 234
             |||||||||||||||||||||
Sbjct: 64875 atgcatccatgcatccatgca 64855
to top
>emb|AL831780.12| Mouse DNA sequence from clone RP23-394B8 on chromosome 2, complete
             sequence
          Length = 173444

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 28499 catgcatccatgcatccatgca 28478



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 28491 catgcatccatgcatccatgca 28470



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 28483 catgcatccatgcatccatgca 28462
to top
>emb|AL929559.12| Zebrafish DNA sequence from clone CH211-106G5 in linkage group 1,
              complete sequence
          Length = 163933

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 137    tacatactgtacacacacactg 158
              ||||||||||||||||||||||
Sbjct: 129940 tacatactgtacacacacactg 129961
to top
>gb|AC154829.2| Mus musculus BAC clone RP24-550F10 from 14, complete sequence
          Length = 136754

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 114678 catgcatccatgcatccatgca 114657



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 114670 catgcatccatgcatccatgca 114649



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 114662 catgcatccatgcatccatgca 114641



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 114654 catgcatccatgcatccatgca 114633



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 114646 catgcatccatgcatccatgca 114625



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 114638 catgcatccatgcatccatgca 114617
to top
>emb|BX004874.11| Zebrafish DNA sequence from clone CH211-39E15 in linkage group 19,
              complete sequence
          Length = 165154

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 138    acatactgtacacacacactgc 159
              ||||||||||||||||||||||
Sbjct: 102721 acatactgtacacacacactgc 102700



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 138   acatactgtacacacacactgc 159
             ||||||||||||||||||||||
Sbjct: 93954 acatactgtacacacacactgc 93933
to top
>gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosome 6, complete sequence
          Length = 217169

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 191262 catgcatccatgcatccatgca 191283
to top
>dbj|AP000439.6| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-44E22, complete
             sequence
          Length = 105962

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 32354 catgcatccatgcatccatgca 32333



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 32346 catgcatccatgcatccatgca 32325
to top
>gb|AC117796.12| Mus musculus chromosome 1, clone RP24-554P6, complete sequence
          Length = 109851

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 84694 catgcatccatgcatccatgca 84715



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 77104 catgcatccatgcatccatgca 77125



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 77096 catgcatccatgcatccatgca 77117



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 77088 catgcatccatgcatccatgca 77109



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 77080 catgcatccatgcatccatgca 77101
to top
>dbj|AP003965.2| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-31O9, complete
              sequence
          Length = 121852

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 102222 catgcatccatgcatccatgca 102201



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 102214 catgcatccatgcatccatgca 102193
to top
>emb|AL831763.6| Mouse DNA sequence from clone RP23-308A23 on chromosome 2, complete
             sequence
          Length = 146436

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 54806 catgcatccatgcatccatgca 54827



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 54798 catgcatccatgcatccatgca 54819



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 54790 catgcatccatgcatccatgca 54811



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 54782 catgcatccatgcatccatgca 54803
to top
>gb|AC133576.10| Mus musculus chromosome 19, clone RP23-204H15, complete sequence
          Length = 213096

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 182049 catgcatccatgcatccatgca 182028
to top
>emb|CR956397.19| Pig DNA sequence from clone CH242-259E5 on chromosome 17, complete
              sequence
          Length = 177531

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 101665 catgcatccatgcatccatgca 101644
to top
>gb|AC145597.4| Mus musculus BAC clone RP24-323M2 from Y, complete sequence
          Length = 199904

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76088 catgcatccatgcatccatgca 76109



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76080 catgcatccatgcatccatgca 76101



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76072 catgcatccatgcatccatgca 76093



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76064 catgcatccatgcatccatgca 76085



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76056 catgcatccatgcatccatgca 76077



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76048 catgcatccatgcatccatgca 76069



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76040 catgcatccatgcatccatgca 76061



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76032 catgcatccatgcatccatgca 76053



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76024 catgcatccatgcatccatgca 76045



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76016 catgcatccatgcatccatgca 76037



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76008 catgcatccatgcatccatgca 76029



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 76000 catgcatccatgcatccatgca 76021



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 15087 catgcatccatgcatccatgca 15108



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 15079 catgcatccatgcatccatgca 15100



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 15071 catgcatccatgcatccatgca 15092



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 15063 catgcatccatgcatccatgca 15084



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 15055 catgcatccatgcatccatgca 15076



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 15047 catgcatccatgcatccatgca 15068



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 15039 catgcatccatgcatccatgca 15060
to top
>gb|AC147639.3| Mus musculus BAC clone RP23-115M6 from 13, complete sequence
          Length = 187485

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 161310 catgcatccatgcatccatgca 161289
to top
>emb|AL672244.15| Mouse DNA sequence from clone RP23-43I8 on chromosome 16, complete
              sequence
          Length = 243114

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 141322 catgcatccatgcatccatgca 141343



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 141314 catgcatccatgcatccatgca 141335



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 141306 catgcatccatgcatccatgca 141327
to top
>emb|AL672051.14| Mouse DNA sequence from clone RP23-332O3 on chromosome X, complete
              sequence
          Length = 163949

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 126247 catgcatccatgcatccatgca 126268



 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    tgcatccatgcatccatgca 234
              ||||||||||||||||||||
Sbjct: 126241 tgcatccatgcatccatgca 126260
to top
>gb|AC002070.1|HSAC002070 Human BAC clone 7E17 from 12q, complete sequence
          Length = 165197

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 86552 catgcatccatgcatccatgca 86531
to top
>dbj|AP005233.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-211G23, complete
              sequence
          Length = 157200

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 125233 catgcatccatgcatccatgca 125212



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 125225 catgcatccatgcatccatgca 125204
to top
>emb|AL607087.10| Mouse DNA sequence from clone RP23-18M1 on chromosome 4, complete
             sequence
          Length = 183786

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 64204 catgcatccatgcatccatgca 64183



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 64196 catgcatccatgcatccatgca 64175



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   catgcatccatgcatccatgca 234
             ||||||||||||||||||||||
Sbjct: 64188 catgcatccatgcatccatgca 64167
to top
>emb|AL606974.9| Mouse DNA sequence from clone RP23-39E21 on chromosome 4, complete
              sequence
          Length = 232587

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 107809 catgcatccatgcatccatgca 107788
to top
>gb|AC121834.4| Mus musculus BAC clone RP24-72F20 from chromosome 5, complete sequence
          Length = 226382

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 118229 catgcatccatgcatccatgca 118208
to top
>gb|AC114494.2| Homo sapiens chromosome 1 clone RP11-439L8, complete sequence
          Length = 146301

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 213    catgcatccatgcatccatgca 234
              ||||||||||||||||||||||
Sbjct: 140498 catgcatccatgcatccatgca 140519
to top
>gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, complete sequence
          Length = 215810

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 214  atgcatccatgcatccatgca 234
            |||||||||||||||||||||
Sbjct: 2159 atgcatccatgcatccatgca 2139
to top
>gb|AY372121.1| Plasmodium falciparum Dd2_var6 erythrocyte membrane protein 1 (var)
           gene, partial cds
          Length = 5753

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 83  gttcttataaacatttttatt 103
           |||||||||||||||||||||
Sbjct: 312 gttcttataaacatttttatt 332
to top
>gb|AC130721.3| Mus musculus BAC clone RP24-333B3 from chromosome 6, complete sequence
          Length = 149502

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 214   atgcatccatgcatccatgca 234
             |||||||||||||||||||||
Sbjct: 18630 atgcatccatgcatccatgca 18610
to top
>gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 map 14, complete sequence
          Length = 180338

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 214    atgcatccatgcatccatgca 234
              |||||||||||||||||||||
Sbjct: 160820 atgcatccatgcatccatgca 160800
to top
>emb|BX649501.24| Zebrafish DNA sequence from clone DKEY-123F20 in linkage group 5,
              complete sequence
          Length = 194220

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 137    tacatactgtacacacacact 157
              |||||||||||||||||||||
Sbjct: 138646 tacatactgtacacacacact 138626
to top
>gb|AC126615.7| Homo sapiens 12 BAC RP11-129B9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 67557

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 214   atgcatccatgcatccatgca 234
             |||||||||||||||||||||
Sbjct: 36204 atgcatccatgcatccatgca 36184
to top
>gb|AC149089.4| Mus musculus BAC clone RP23-94H23 from 6, complete sequence
          Length = 189070

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 214    atgcatccatgcatccatgca 234
              |||||||||||||||||||||
Sbjct: 162842 atgcatccatgcatccatgca 162822
to top
>dbj|AP002004.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-693N9, complete
              sequence
          Length = 172081

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 85     tcttataaacatttttattcc 105
              |||||||||||||||||||||
Sbjct: 105321 tcttataaacatttttattcc 105341
to top
>gb|AC110509.21| Mus musculus chromosome 8, clone RP24-423G4, complete sequence
          Length = 190160

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 147    acacacacactgcataattg 166
              ||||||||||||||||||||
Sbjct: 124134 acacacacactgcataattg 124115
to top
>gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section 6 of 9 of the complete
             sequence
          Length = 250421

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    gttcttataaacatttttat 102
             ||||||||||||||||||||
Sbjct: 57626 gttcttataaacatttttat 57607
to top
>gb|AC003057.1| Mouse Cosmid ma08m030 from 14D1-D2, complete sequence
          Length = 33608

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   catgcatccatgcatccatg 232
             ||||||||||||||||||||
Sbjct: 20918 catgcatccatgcatccatg 20899
to top
>gb|AC115013.18| Mus musculus chromosome 10, clone RP24-193P19, complete sequence
          Length = 183402

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    ttcttataaacatttttatt 103
             ||||||||||||||||||||
Sbjct: 60692 ttcttataaacatttttatt 60673
to top
>gb|BC068929.1| Xenopus laevis hypothetical protein LOC414705, mRNA (cDNA clone
           IMAGE:6631307), partial cds
          Length = 1304

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  gttcttataaacatttttat 102
           ||||||||||||||||||||
Sbjct: 709 gttcttataaacatttttat 728
to top
>gb|U39740.1| Caenorhabditis elegans cosmid ZC64, complete sequence
          Length = 36148

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 61    aaccaaaatgttagaattga 80
             ||||||||||||||||||||
Sbjct: 25769 aaccaaaatgttagaattga 25750
to top
>gb|AC158549.8| Mus musculus chromosome 19, clone RP24-216K4, complete sequence
          Length = 195500

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 212   acatgcatccatgcatccatgcac 235
             ||||||||||| ||||||||||||
Sbjct: 86034 acatgcatccaggcatccatgcac 86057
to top
>gb|AC139223.8| Mus musculus chromosome 8, clone RP24-322F24, complete sequence
          Length = 180051

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    gattcctttatccttctaaa 35
             ||||||||||||||||||||
Sbjct: 72114 gattcctttatccttctaaa 72133
to top
>emb|BX957236.8| Zebrafish DNA sequence from clone DKEY-178O3 in linkage group 6,
            complete sequence
          Length = 211391

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 137  tacatactgtacacacacac 156
            ||||||||||||||||||||
Sbjct: 4586 tacatactgtacacacacac 4567
to top
>gb|AC010927.5|ATAC010927 Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence,
             complete sequence
          Length = 96232

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     tcataaagtacaaagattcc 21
             ||||||||||||||||||||
Sbjct: 76549 tcataaagtacaaagattcc 76530
to top
>emb|CR388035.9| Zebrafish DNA sequence from clone DKEY-104O19, complete sequence
          Length = 158403

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 137    tacatactgtacacacacactgca 160
              ||||||||||| ||||||||||||
Sbjct: 119272 tacatactgtatacacacactgca 119295
to top
>emb|AL672152.8| Mouse DNA sequence from clone RP23-426A16 on chromosome X, complete
              sequence
          Length = 200643

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 214    atgcatccatgcatccatgc 233
              ||||||||||||||||||||
Sbjct: 133757 atgcatccatgcatccatgc 133776
to top
>emb|BX927186.21| Zebrafish DNA sequence from clone DKEY-29H4 in linkage group 17,
             complete sequence
          Length = 197409

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 138   acatactgtacacacacact 157
             ||||||||||||||||||||
Sbjct: 37463 acatactgtacacacacact 37444
to top
>emb|AL391497.9| Human DNA sequence from clone RP11-302M6 on chromosome 1 Contains the
             3' end of the LRRC5 gene for leucine rich repeat
             containing 5, a two novel genes, a novel pseudogene, the
             5' end of a novel gene (FLJ20403) and a CpG island,
             complete sequence
          Length = 189762

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   acatgcatccatgcatccat 231
             ||||||||||||||||||||
Sbjct: 61255 acatgcatccatgcatccat 61236
to top
>emb|BX883042.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 1/11
          Length = 348780

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     taaacatttttattcctaaa 109
              ||||||||||||||||||||
Sbjct: 292521 taaacatttttattcctaaa 292540
to top
>emb|BX537277.15| Zebrafish DNA sequence from clone DKEY-45D16 in linkage group 2,
             complete sequence
          Length = 263014

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   tacatactgtacacacacac 156
             ||||||||||||||||||||
Sbjct: 66494 tacatactgtacacacacac 66475
to top
>gb|AC120387.5| Mus musculus chromosome 8, clone RP24-299O22, complete sequence
          Length = 163623

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 16   gattcctttatccttctaaa 35
            ||||||||||||||||||||
Sbjct: 9805 gattcctttatccttctaaa 9786
to top
>emb|BX908743.5| Zebrafish DNA sequence from clone RP71-3H8 in linkage group 8,
            complete sequence
          Length = 69416

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 138  acatactgtacacacacact 157
            ||||||||||||||||||||
Sbjct: 7045 acatactgtacacacacact 7026
to top
>emb|AJ632304.1| Cotesia congregata virus complete genome, segment Circle1
          Length = 27346

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 215  tgcatccatgcatccatgca 234
            ||||||||||||||||||||
Sbjct: 2980 tgcatccatgcatccatgca 2961
to top
>gb|AC120734.5| Rattus norvegicus  BAC CH230-220D1 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 232990

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 90     taaacatttttattcctaaa 109
              ||||||||||||||||||||
Sbjct: 223245 taaacatttttattcctaaa 223226
to top
>gb|AC149225.18| Danio rerio clone ch211-103f17, complete sequence
          Length = 185038

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    tacatactgtacacacacac 156
              ||||||||||||||||||||
Sbjct: 164594 tacatactgtacacacacac 164613
to top
>gb|AC010701.3| Drosophila melanogaster 3L BAC RP98-26P10 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 174920

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   catgcatccatgcatccatg 232
             ||||||||||||||||||||
Sbjct: 78841 catgcatccatgcatccatg 78860
to top
>emb|BX908736.10| Zebrafish DNA sequence from clone CH211-229C8 in linkage group 18,
             complete sequence
          Length = 159047

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 139   catactgtacacacacactg 158
             ||||||||||||||||||||
Sbjct: 94696 catactgtacacacacactg 94677
to top
>gb|DP000005.1| Macaca mulatta target 1 genomic scaffold
          Length = 1678549

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 213    catgcatccatgcatccatg 232
              ||||||||||||||||||||
Sbjct: 628142 catgcatccatgcatccatg 628161
to top
>gb|AE008686.1|AE008686 Mus musculus T-cell receptor alpha/delta locus  section 4 of 4 of the
              complete region
          Length = 461875

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 213    catgcatccatgcatccatg 232
              ||||||||||||||||||||
Sbjct: 309774 catgcatccatgcatccatg 309755
to top
>gb|AY167135.1| Drosophila willistoni RPS18 gene, partial cds; PLU (plu) gene,
            complete cds; and PCNA gene, partial cds
          Length = 1525

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 84   ttcttataaacatttttatt 103
            ||||||||||||||||||||
Sbjct: 1139 ttcttataaacatttttatt 1120
to top
>gb|AF284354.1|AF284354 Acanthopagrus butcheri clone 2A5 microsatellite sequence
          Length = 219

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 137 tacatactgtacacacacac 156
           ||||||||||||||||||||
Sbjct: 165 tacatactgtacacacacac 146
to top
>gb|AC000067.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 100h In DGCR Region,
             complete sequence
          Length = 40645

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   catgcatccatgcatccatg 232
             ||||||||||||||||||||
Sbjct: 28120 catgcatccatgcatccatg 28101
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     aaagattcctttatccttct 32
              ||||||||||||||||||||
Sbjct: 793303 aaagattcctttatccttct 793284
to top
>gb|AC154285.2| Mus musculus BAC clone RP23-452P8 from chromosome 16, complete sequence
          Length = 183796

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 92     aacatttttattcctaaatg 111
              ||||||||||||||||||||
Sbjct: 166464 aacatttttattcctaaatg 166445
to top
>gb|AC130184.4| Macaca mulatta clone CH250-513J21, complete sequence
          Length = 160850

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   catgcatccatgcatccatg 232
             ||||||||||||||||||||
Sbjct: 27797 catgcatccatgcatccatg 27816
to top
>gb|AC128714.15| Homo sapiens 3 BAC RP11-433C9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109972

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    aaatgttagaattgagagtt 85
             ||||||||||||||||||||
Sbjct: 90194 aaatgttagaattgagagtt 90213
to top
>dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1442_E05
          Length = 162407

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 13   aaagattcctttatccttct 32
            ||||||||||||||||||||
Sbjct: 2511 aaagattcctttatccttct 2492
to top
>dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0036E06
          Length = 137926

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    aaagattcctttatccttct 32
             ||||||||||||||||||||
Sbjct: 71434 aaagattcctttatccttct 71415
to top
>emb|AL935114.8| Zebrafish DNA sequence from clone CH211-182P11, complete sequence
          Length = 152177

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   tacatactgtacacacacac 156
             ||||||||||||||||||||
Sbjct: 64575 tacatactgtacacacacac 64556
to top
>emb|BX004769.9| Zebrafish DNA sequence from clone DKEY-15I8 in linkage group 9,
             complete sequence
          Length = 154745

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 138   acatactgtacacacacact 157
             ||||||||||||||||||||
Sbjct: 28494 acatactgtacacacacact 28513
to top
>emb|BX323086.4| Zebrafish DNA sequence from clone DKEY-170I11 in linkage group 20,
             complete sequence
          Length = 183026

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   tacatactgtacacacacac 156
             ||||||||||||||||||||
Sbjct: 76156 tacatactgtacacacacac 76137
to top
>emb|AL935117.16| Zebrafish DNA sequence from clone CH211-197G22 in linkage group 18,
             complete sequence
          Length = 213808

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   tacatactgtacacacacac 156
             ||||||||||||||||||||
Sbjct: 75475 tacatactgtacacacacac 75494
to top
>gb|AE003595.3| Drosophila melanogaster chromosome 3L, section 76 of 83 of the complete
             sequence
          Length = 294272

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   catgcatccatgcatccatg 232
             ||||||||||||||||||||
Sbjct: 11099 catgcatccatgcatccatg 11080
to top
>emb|AL163872.2|CNS05TBN Human chromosome 14 DNA sequence BAC R-76E12 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 168486

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    gagagttcttataaacattt 98
             ||||||||||||||||||||
Sbjct: 95915 gagagttcttataaacattt 95934
to top
>emb|AL691448.24| Mouse DNA sequence from clone RP23-103A1 on chromosome 11, complete
              sequence
          Length = 197959

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    acatgcatccatgcatccat 231
              ||||||||||||||||||||
Sbjct: 107213 acatgcatccatgcatccat 107232
to top
>emb|AL928963.8| Mouse DNA sequence from clone RP23-5K9 on chromosome 2, complete sequence
          Length = 216315

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 212    acatgcatccatgcatccatgcac 235
              |||||||| |||||||||||||||
Sbjct: 187042 acatgcatgcatgcatccatgcac 187065


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,321,976
Number of Sequences: 3902068
Number of extensions: 3321976
Number of successful extensions: 105174
Number of sequences better than 10.0: 107
Number of HSP's better than 10.0 without gapping: 107
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 104265
Number of HSP's gapped (non-prelim): 899
length of query: 273
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 251
effective length of database: 17,147,199,772
effective search space: 4303947142772
effective search space used: 4303947142772
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top