>gb|AC119943.12| Mus musculus chromosome 10, clone RP24-271F24, complete sequence
          Length = 174009

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 29    gttgaatatacatgcatgtaca 50
             ||||||||||||||||||||||
Sbjct: 63950 gttgaatatacatgcatgtaca 63929

>gb|AC084272.41| Mus musculus strain C57BL/6J clone rp23-11g21 map 3, complete sequence
          Length = 206230

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 85     tccacgtatttcagtctgttat 106
              ||||||||||||||||||||||
Sbjct: 180174 tccacgtatttcagtctgttat 180195

>gb|AC160403.5| Mus musculus 10 BAC RP24-286J14 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 180869

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 29     gttgaatatacatgcatgtaca 50
              ||||||||||||||||||||||
Sbjct: 142995 gttgaatatacatgcatgtaca 142974

>gb|AC140190.3| Mus musculus BAC clone RP24-372P19 from 3, complete sequence
          Length = 205702

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 85    tccacgtatttcagtctgttat 106
             ||||||||||||||||||||||
Sbjct: 64925 tccacgtatttcagtctgttat 64946

>gb|CP000238.1| Baumannia cicadellinicola str. Hc (Homalodisca coagulata), complete
              genome
          Length = 686194

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 264    ataccatcgccaattagcgga 284
              |||||||||||||||||||||
Sbjct: 563518 ataccatcgccaattagcgga 563538

>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence
          Length = 2205233

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     aatatacatgcatgtacagg 52
              ||||||||||||||||||||
Sbjct: 874975 aatatacatgcatgtacagg 874994

>gb|AC159429.1| Trypanosoma brucei chromosome 7 clone RPCI93-28B13, complete sequence
          Length = 152128

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     aatatacatgcatgtacagg 52
              ||||||||||||||||||||
Sbjct: 117902 aatatacatgcatgtacagg 117883

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 38      acatgcatgtacaggtaaca 57
               ||||||||||||||||||||
Sbjct: 3367097 acatgcatgtacaggtaaca 3367078

>gb|AC105729.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1607A12,
             complete sequence
          Length = 177327

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 38    acatgcatgtacaggtaaca 57
             ||||||||||||||||||||
Sbjct: 62117 acatgcatgtacaggtaaca 62136

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 38      acatgcatgtacaggtaaca 57
               ||||||||||||||||||||
Sbjct: 3367208 acatgcatgtacaggtaaca 3367189

>gb|AF226853.1|AF226853 Bacteriophage phi-8 segment S, complete sequence
          Length = 3192

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 75   tttctgagcttccacgtatt 94
            ||||||||||||||||||||
Sbjct: 2288 tttctgagcttccacgtatt 2269


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,514,213
Number of Sequences: 3902068
Number of extensions: 2514213
Number of successful extensions: 47328
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47279
Number of HSP's gapped (non-prelim): 49
length of query: 358
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 336
effective length of database: 17,147,199,772
effective search space: 5761459123392
effective search space used: 5761459123392
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)