ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart52g04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_190147.1| Oryza sativa (japonica cultivar-group), predic... 101 1e-18
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 101 1e-18
3dbj|AP003261.3| Oryza sativa (japonica cultivar-group) genomic D... 101 1e-18
4dbj|AP003227.3| Oryza sativa (japonica cultivar-group) genomic D... 101 1e-18
5dbj|AK065053.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 1e-18
6ref|NM_126153.2| Arabidopsis thaliana peptidyl-prolyl cis-trans ... 52 0.001
7ref|NM_126154.3| Arabidopsis thaliana unknown protein AT5G67540 ... 52 0.001
8ref|NM_203279.1| Arabidopsis thaliana unknown protein AT5G67540 ... 52 0.001
9gb|AY101528.1| Arabidopsis thaliana AT5g67540/K9I9_10 mRNA, comp... 52 0.001
10gb|AF446357.1|AF446357 Arabidopsis thaliana AT5g67540/K9I9_10 mR... 52 0.001
11emb|BX831832.1|CNS0A1RN Arabidopsis thaliana Full-length cDNA Co... 52 0.001
12emb|BX831838.1|CNS0A11T Arabidopsis thaliana Full-length cDNA Co... 52 0.001
13dbj|AB013390.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 52 0.001
14emb|AJ132745.1|ATH132745 Arabidopsis thaliana hypothetical prote... 52 0.001
15emb|AL137861.5| Human DNA sequence from clone RP4-813B7 on chrom... 42 1.1
16emb|AL732603.3| Mouse DNA sequence from clone RP23-154H8 on chro... 42 1.1
17gb|AC102320.6| Mus musculus chromosome 1, clone RP24-459A11, com... 40 4.3
18ref|NM_186193.2| Oryza sativa (japonica cultivar-group), mRNA 40 4.3
19gb|AF401203.1| Homo sapiens chAB4 multisequence family and NF1-r... 40 4.3
20gb|AC147649.2| Homo sapiens BAC clone RP11-188B11 from UL, compl... 40 4.3
21gb|AC148027.3| Homo sapiens BAC clone RP11-184H2 from UL, comple... 40 4.3
22gb|AC183918.1| Homo sapiens BAC clone RP11-170N9 from chromosome... 40 4.3
23gb|AC134878.3| Homo sapiens BAC clone RP11-131M6 from Y, complet... 40 4.3
24emb|CT010480.10| Mouse DNA sequence from clone RP23-313E11 on ch... 40 4.3
25gb|AC145652.2| Homo sapiens fosmid clone XXFOS-87329F3 from 4, c... 40 4.3
26gb|BC015658.2| Homo sapiens cDNA clone IMAGE:4843460, partial cds 40 4.3
27emb|Z94055.1|HS24M15 Human DNA sequence from clone RP1-24M15 on ... 40 4.3
28emb|AL451134.8| Human DNA sequence from clone RP11-59J4 on chrom... 40 4.3
29gb|AC138772.4| Homo sapiens BAC clone RP11-1345A16 from UL, comp... 40 4.3
30gb|AC145212.1| Homo sapiens BAC clone RP11-1368F8 from UL, compl... 40 4.3
31gb|AC138771.4| Homo sapiens BAC clone RP11-1338E21 from UL, comp... 40 4.3
32gb|AC138774.4| Homo sapiens BAC clone RP11-1320P3 from UL, compl... 40 4.3
33emb|CR936327.2| Medicago truncatula chromosome 5 clone mte1-68g1... 40 4.3
34emb|CR381653.11| Human DNA sequence from clone bP-21264C1 on chr... 40 4.3
35emb|CR392039.8| Human DNA sequence from clone bP-2171C21 on chro... 40 4.3
36emb|CR381535.11| Human DNA sequence from clone bP-2154M18 on chr... 40 4.3
37dbj|AK098337.1| Homo sapiens cDNA FLJ41018 fis, clone UTERU2018881 40 4.3
38gb|AC182471.3| Pan troglodytes BAC clone CH251-352M13 from chrom... 40 4.3
39gb|AC092597.1| Homo sapiens BAC clone RP11-100N21 from 4, comple... 40 4.3
40ref|XR_000988.1| PREDICTED: Homo sapiens hypothetical LOC401131,... 40 4.3
41gb|BC014871.1|BC014871 Homo sapiens, clone IMAGE:3925346, mRNA, ... 40 4.3
42emb|CR381670.5| Human DNA sequence from clone bP-2189O9 on chrom... 40 4.3
43gb|AC138775.3| Homo sapiens BAC clone RP11-1247B7 from chromosom... 40 4.3
44dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.3
45gb|AC007839.4|AC007839 Drosophila melanogaster, chromosome 2R, r... 40 4.3
46gb|AC147060.2| Homo sapiens BAC clone RP11-268B15 from 4, comple... 40 4.3
47gb|AC145621.2| Homo sapiens BAC clone RP11-365B19 from 4, comple... 40 4.3
48gb|AC138776.2| Homo sapiens BAC clone RP11-1277N13 from UL, comp... 40 4.3
49gb|AC118282.4| Homo sapiens BAC clone RP11-1281K21 from 4, compl... 40 4.3
50gb|AC138777.3| Homo sapiens BAC clone RP11-1220P14 from 2, compl... 40 4.3
51gb|AC119751.3| Homo sapiens BAC clone RP11-241F15 from 4, comple... 40 4.3
52dbj|AP003746.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.3
53gb|AC159541.1| Homo sapiens chromosome UNKNOWN clone RP11-77B18,... 40 4.3
54gb|AC148028.2| Homo sapiens chromosome UNKNOWN clone RP11-238G20... 40 4.3
55gb|AC148030.2| Homo sapiens chromosome UNKNOWN clone RP11-134K23... 40 4.3
56emb|BX571672.10| Human DNA sequence from clone RP11-782C8 on chr... 40 4.3
57emb|BX640538.4| Human DNA sequence from clone RP6-238B6 on chrom... 40 4.3
58emb|AL354822.8| Human DNA sequence from clone RP11-474C22 on chr... 40 4.3
59emb|BX572084.5| Human DNA sequence from clone RP11-423O2 on chro... 40 4.3
60dbj|AK100372.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.3
61emb|AL583842.40| Human DNA sequence from clone RP11-417J8 on chr... 40 4.3
62gb|AE003797.3| Drosophila melanogaster chromosome 2R, section 53... 40 4.3
63emb|AL137218.5| Human DNA sequence from clone RP11-111E21, compl... 40 4.3
64emb|AL355793.6| Human DNA sequence from clone RP4-694M10 on chro... 40 4.3
65emb|BX004987.9| Human DNA sequence from clone RP11-435B5 on chro... 40 4.3
66emb|CR974483.16| Mouse DNA sequence from clone RP23-296D10 on ch... 40 4.3
67emb|AL590523.5| Human DNA sequence from clone RP11-565G5 on chro... 40 4.3
68dbj|AK090412.1| Homo sapiens mRNA for FLJ00310 protein 40 4.3
69emb|AL355973.21| Human DNA sequence from clone RP4-660N4 on chro... 40 4.3 
>ref|NM_190147.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1398

 Score =  101 bits (51), Expect = 1e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                        
Query: 189  ccaaccttcagggaggcgccatttcctgtgccaataaatcgacaccctcgaccacgacgg 248
            ||||| |||||| |||||||||||||||||||||||||| |||||||||||||| | |||
Sbjct: 1383 ccaactttcaggtaggcgccatttcctgtgccaataaatggacaccctcgaccatgccgg 1324

                                   
Query: 249  gaacccgaagctgtaatccaacg 271
            ||| || || |||||||||||||
Sbjct: 1323 gaatccaaaactgtaatccaacg 1301
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  101 bits (51), Expect = 1e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                            
Query: 189      ccaaccttcagggaggcgccatttcctgtgccaataaatcgacaccctcgaccacgacgg 248
                ||||| |||||| |||||||||||||||||||||||||| |||||||||||||| | |||
Sbjct: 38149996 ccaactttcaggtaggcgccatttcctgtgccaataaatggacaccctcgaccatgccgg 38149937

                                       
Query: 249      gaacccgaagctgtaatccaacg 271
                ||| || || |||||||||||||
Sbjct: 38149936 gaatccaaaactgtaatccaacg 38149914
to top
>dbj|AP003261.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0471B04
          Length = 138025

 Score =  101 bits (51), Expect = 1e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                          
Query: 189    ccaaccttcagggaggcgccatttcctgtgccaataaatcgacaccctcgaccacgacgg 248
              ||||| |||||| |||||||||||||||||||||||||| |||||||||||||| | |||
Sbjct: 118030 ccaactttcaggtaggcgccatttcctgtgccaataaatggacaccctcgaccatgccgg 117971

                                     
Query: 249    gaacccgaagctgtaatccaacg 271
              ||| || || |||||||||||||
Sbjct: 117970 gaatccaaaactgtaatccaacg 117948
to top
>dbj|AP003227.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0018C10
          Length = 200183

 Score =  101 bits (51), Expect = 1e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                         
Query: 189   ccaaccttcagggaggcgccatttcctgtgccaataaatcgacaccctcgaccacgacgg 248
             ||||| |||||| |||||||||||||||||||||||||| |||||||||||||| | |||
Sbjct: 69230 ccaactttcaggtaggcgccatttcctgtgccaataaatggacaccctcgaccatgccgg 69171

                                    
Query: 249   gaacccgaagctgtaatccaacg 271
             ||| || || |||||||||||||
Sbjct: 69170 gaatccaaaactgtaatccaacg 69148
to top
>dbj|AK065053.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001I24, full
            insert sequence
          Length = 1842

 Score =  101 bits (51), Expect = 1e-18
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                        
Query: 189  ccaaccttcagggaggcgccatttcctgtgccaataaatcgacaccctcgaccacgacgg 248
            ||||| |||||| |||||||||||||||||||||||||| |||||||||||||| | |||
Sbjct: 1592 ccaactttcaggtaggcgccatttcctgtgccaataaatggacaccctcgaccatgccgg 1533

                                   
Query: 249  gaacccgaagctgtaatccaacg 271
            ||| || || |||||||||||||
Sbjct: 1532 gaatccaaaactgtaatccaacg 1510
to top
>ref|NM_126153.2| Arabidopsis thaliana peptidyl-prolyl cis-trans isomerase/
            ubiquitin-protein ligase AT5G67530 mRNA, complete cds
          Length = 2962

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 205  cgccatttcctgtgccaataaatcgacaccctcgaccacgacgggaacccgaag 258
            |||||||| |||||||| || || ||||| || |||||||| ||||||||||||
Sbjct: 2251 cgccatttactgtgccagtagatggacactctggaccacgatgggaacccgaag 2304
to top
>ref|NM_126154.3| Arabidopsis thaliana unknown protein AT5G67540 transcript variant
            AT5G67540.1 mRNA, complete cds
          Length = 1933

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 205  cgccatttcctgtgccaataaatcgacaccctcgaccacgacgggaacccgaag 258
            |||||||| |||||||| || || ||||| || |||||||| ||||||||||||
Sbjct: 1698 cgccatttactgtgccagtagatggacactctggaccacgatgggaacccgaag 1645
to top
>ref|NM_203279.1| Arabidopsis thaliana unknown protein AT5G67540 transcript variant
            AT5G67540.2 mRNA, complete cds
          Length = 2016

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 205  cgccatttcctgtgccaataaatcgacaccctcgaccacgacgggaacccgaag 258
            |||||||| |||||||| || || ||||| || |||||||| ||||||||||||
Sbjct: 1781 cgccatttactgtgccagtagatggacactctggaccacgatgggaacccgaag 1728
to top
>gb|AY101528.1| Arabidopsis thaliana AT5g67540/K9I9_10 mRNA, complete cds
          Length = 1401

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 205  cgccatttcctgtgccaataaatcgacaccctcgaccacgacgggaacccgaag 258
            |||||||| |||||||| || || ||||| || |||||||| ||||||||||||
Sbjct: 1391 cgccatttactgtgccagtagatggacactctggaccacgatgggaacccgaag 1338
to top
>gb|AF446357.1|AF446357 Arabidopsis thaliana AT5g67540/K9I9_10 mRNA, complete cds
          Length = 1843

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 205  cgccatttcctgtgccaataaatcgacaccctcgaccacgacgggaacccgaag 258
            |||||||| |||||||| || || ||||| || |||||||| ||||||||||||
Sbjct: 1700 cgccatttactgtgccagtagatggacactctggaccacgatgggaacccgaag 1647
to top
>emb|BX831832.1|CNS0A1RN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH32ZA09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 687

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 205 cgccatttcctgtgccaataaatcgacaccctcgaccacgacgggaacccgaag 258
           |||||||| |||||||| || || ||||| || |||||||| ||||||||||||
Sbjct: 546 cgccatttactgtgccagtagatggacactctggaccacgatgggaacccgaag 493
to top
>emb|BX831838.1|CNS0A11T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH32ZE05 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1876

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 205  cgccatttcctgtgccaataaatcgacaccctcgaccacgacgggaacccgaag 258
            |||||||| |||||||| || || ||||| || |||||||| ||||||||||||
Sbjct: 1774 cgccatttactgtgccagtagatggacactctggaccacgatgggaacccgaag 1721
to top
>dbj|AB013390.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9I9
          Length = 51860

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                   
Query: 205   cgccatttcctgtgccaataaatcgacaccctcgaccacgacgggaacccgaag 258
             |||||||| |||||||| || || ||||| || |||||||| ||||||||||||
Sbjct: 23429 cgccatttactgtgccagtagatggacactctggaccacgatgggaacccgaag 23482
to top
>emb|AJ132745.1|ATH132745 Arabidopsis thaliana hypothetical protein, clone EMG9a29
          Length = 720

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 205 cgccatttcctgtgccaataaatcgacaccctcgaccacgacgggaacccgaag 258
           |||||||| |||||||| || || ||||| || |||||||| ||||||||||||
Sbjct: 712 cgccatttactgtgccagtagatggacactctggaccacgatgggaacccgaag 659
to top
>emb|AL137861.5| Human DNA sequence from clone RP4-813B7 on chromosome 1 Contains a
             pseudogene similar to zinc finger protein ZNF186, STSs and
             GSSs, complete sequence
          Length = 127682

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   ctcttctcttcttcttgccta 155
             |||||||||||||||||||||
Sbjct: 51471 ctcttctcttcttcttgccta 51491
to top
>emb|AL732603.3| Mouse DNA sequence from clone RP23-154H8 on chromosome 2, complete
             sequence
          Length = 87251

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 123   ctttccagactgctcttctct 143
             |||||||||||||||||||||
Sbjct: 83693 ctttccagactgctcttctct 83713
to top
>gb|AC102320.6| Mus musculus chromosome 1, clone RP24-459A11, complete sequence
          Length = 121264

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 82062 ctcttctcttcttcttgcct 82081
to top
>ref|NM_186193.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2284

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 236 tcgaccacgacgggaacccg 255
           ||||||||||||||||||||
Sbjct: 415 tcgaccacgacgggaacccg 434
to top
>gb|AF401203.1| Homo sapiens chAB4 multisequence family and NF1-related multisequence
             family regions
          Length = 86723

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 54047 ctcttctcttcttcttgcct 54066
to top
>gb|AC147649.2| Homo sapiens BAC clone RP11-188B11 from UL, complete sequence
          Length = 150742

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 56776 ctcttctcttcttcttgcct 56757
to top
>gb|AC148027.3| Homo sapiens BAC clone RP11-184H2 from UL, complete sequence
          Length = 148764

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 81052 ctcttctcttcttcttgcct 81071
to top
>gb|AC183918.1| Homo sapiens BAC clone RP11-170N9 from chromosome unknown, complete
             sequence
          Length = 151064

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 58155 ctcttctcttcttcttgcct 58174
to top
>gb|AC134878.3| Homo sapiens BAC clone RP11-131M6 from Y, complete sequence
          Length = 155813

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 73677 ctcttctcttcttcttgcct 73696
to top
>emb|CT010480.10| Mouse DNA sequence from clone RP23-313E11 on chromosome 13, complete
             sequence
          Length = 203636

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   actgctcttctcttcttctt 150
             ||||||||||||||||||||
Sbjct: 61086 actgctcttctcttcttctt 61067
to top
>gb|AC145652.2| Homo sapiens fosmid clone XXFOS-87329F3 from 4, complete sequence
          Length = 41343

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 135  ctcttctcttcttcttgcct 154
            ||||||||||||||||||||
Sbjct: 5349 ctcttctcttcttcttgcct 5368
to top
>gb|BC015658.2| Homo sapiens cDNA clone IMAGE:4843460, partial cds
          Length = 1441

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 135  ctcttctcttcttcttgcct 154
            ||||||||||||||||||||
Sbjct: 1142 ctcttctcttcttcttgcct 1123
to top
>emb|Z94055.1|HS24M15 Human DNA sequence from clone RP1-24M15 on chromosome 1q24-25 Contains
             part of the TNR gene fortenascin R (restrictin, janusin),
             complete sequence
          Length = 134539

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   ctcttcccccaaccttcagg 200
             ||||||||||||||||||||
Sbjct: 87138 ctcttcccccaaccttcagg 87157
to top
>emb|AL451134.8| Human DNA sequence from clone RP11-59J4 on chromosome 1 Contains part
             of the AIM2 gene for absent in melanoma 2, complete
             sequence
          Length = 49349

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     aaaaaatcatttcccaacac 25
             ||||||||||||||||||||
Sbjct: 18458 aaaaaatcatttcccaacac 18439
to top
>gb|AC138772.4| Homo sapiens BAC clone RP11-1345A16 from UL, complete sequence
          Length = 213227

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 69310 ctcttctcttcttcttgcct 69329
to top
>gb|AC145212.1| Homo sapiens BAC clone RP11-1368F8 from UL, complete sequence
          Length = 191469

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    ctcttctcttcttcttgcct 154
              ||||||||||||||||||||
Sbjct: 105001 ctcttctcttcttcttgcct 104982
to top
>gb|AC138771.4| Homo sapiens BAC clone RP11-1338E21 from UL, complete sequence
          Length = 157733

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 91666 ctcttctcttcttcttgcct 91647
to top
>gb|AC138774.4| Homo sapiens BAC clone RP11-1320P3 from UL, complete sequence
          Length = 194050

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 84323 ctcttctcttcttcttgcct 84342
to top
>emb|CR936327.2| Medicago truncatula chromosome 5 clone mte1-68g1, COMPLETE SEQUENCE
          Length = 116729

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 148    cttgcctaaaaagacattca 167
              ||||||||||||||||||||
Sbjct: 110906 cttgcctaaaaagacattca 110925
to top
>emb|CR381653.11| Human DNA sequence from clone bP-21264C1 on chromosome 21, complete
             sequence
          Length = 131056

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 95568 ctcttctcttcttcttgcct 95587
to top
>emb|CR392039.8| Human DNA sequence from clone bP-2171C21 on chromosome 21, complete
             sequence
          Length = 158069

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 24965 ctcttctcttcttcttgcct 24984
to top
>emb|CR381535.11| Human DNA sequence from clone bP-2154M18 on chromosome 21, complete
             sequence
          Length = 152296

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 75919 ctcttctcttcttcttgcct 75900
to top
>dbj|AK098337.1| Homo sapiens cDNA FLJ41018 fis, clone UTERU2018881
          Length = 2493

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 135 ctcttctcttcttcttgcct 154
           ||||||||||||||||||||
Sbjct: 427 ctcttctcttcttcttgcct 446
to top
>gb|AC182471.3| Pan troglodytes BAC clone CH251-352M13 from chromosome unknown, complete
              sequence
          Length = 170022

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    ctcttctcttcttcttgcct 154
              ||||||||||||||||||||
Sbjct: 122923 ctcttctcttcttcttgcct 122904
to top
>gb|AC092597.1| Homo sapiens BAC clone RP11-100N21 from 4, complete sequence
          Length = 168177

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 132    ctgctcttctcttcttcttg 151
              ||||||||||||||||||||
Sbjct: 101553 ctgctcttctcttcttcttg 101534
to top
>ref|XR_000988.1| PREDICTED: Homo sapiens hypothetical LOC401131, transcript variant 2
            (LOC401131), misc RNA
          Length = 6044

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 135  ctcttctcttcttcttgcct 154
            ||||||||||||||||||||
Sbjct: 4817 ctcttctcttcttcttgcct 4798
to top
>gb|BC014871.1|BC014871 Homo sapiens, clone IMAGE:3925346, mRNA, partial cds
          Length = 1638

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 135 ctcttctcttcttcttgcct 154
           ||||||||||||||||||||
Sbjct: 510 ctcttctcttcttcttgcct 529
to top
>emb|CR381670.5| Human DNA sequence from clone bP-2189O9 on chromosome 21, complete
             sequence
          Length = 129889

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 18662 ctcttctcttcttcttgcct 18681
to top
>gb|AC138775.3| Homo sapiens BAC clone RP11-1247B7 from chromosome 2, complete sequence
          Length = 210658

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 84117 ctcttctcttcttcttgcct 84136
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 236    tcgaccacgacgggaacccg 255
              ||||||||||||||||||||
Sbjct: 658186 tcgaccacgacgggaacccg 658205
to top
>gb|AC007839.4|AC007839 Drosophila melanogaster, chromosome 2R, region 56B1-56C4, BAC clone
             BACR01N09, complete sequence
          Length = 161172

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   actgctcttctcttcttctt 150
             ||||||||||||||||||||
Sbjct: 88223 actgctcttctcttcttctt 88242
to top
>gb|AC147060.2| Homo sapiens BAC clone RP11-268B15 from 4, complete sequence
          Length = 174548

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 21260 ctcttctcttcttcttgcct 21279
to top
>gb|AC145621.2| Homo sapiens BAC clone RP11-365B19 from 4, complete sequence
          Length = 167934

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 21260 ctcttctcttcttcttgcct 21279
to top
>gb|AC138776.2| Homo sapiens BAC clone RP11-1277N13 from UL, complete sequence
          Length = 202926

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    ctcttctcttcttcttgcct 154
              ||||||||||||||||||||
Sbjct: 182972 ctcttctcttcttcttgcct 182953
to top
>gb|AC118282.4| Homo sapiens BAC clone RP11-1281K21 from 4, complete sequence
          Length = 208765

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 135    ctcttctcttcttcttgcct 154
              ||||||||||||||||||||
Sbjct: 103028 ctcttctcttcttcttgcct 103047
to top
>gb|AC138777.3| Homo sapiens BAC clone RP11-1220P14 from 2, complete sequence
          Length = 220281

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    ctcttctcttcttcttgcct 154
              ||||||||||||||||||||
Sbjct: 115285 ctcttctcttcttcttgcct 115266
to top
>gb|AC119751.3| Homo sapiens BAC clone RP11-241F15 from 4, complete sequence
          Length = 171176

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    ctcttctcttcttcttgcct 154
              ||||||||||||||||||||
Sbjct: 132210 ctcttctcttcttcttgcct 132191
to top
>dbj|AP003746.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1123_C12
          Length = 114309

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 236   tcgaccacgacgggaacccg 255
             ||||||||||||||||||||
Sbjct: 92688 tcgaccacgacgggaacccg 92707
to top
>gb|AC159541.1| Homo sapiens chromosome UNKNOWN clone RP11-77B18, complete sequence
          Length = 143003

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 86453 ctcttctcttcttcttgcct 86434
to top
>gb|AC148028.2| Homo sapiens chromosome UNKNOWN clone RP11-238G20, complete sequence
          Length = 172857

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 99049 ctcttctcttcttcttgcct 99030
to top
>gb|AC148030.2| Homo sapiens chromosome UNKNOWN clone RP11-134K23, complete sequence
          Length = 157579

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 80743 ctcttctcttcttcttgcct 80762
to top
>emb|BX571672.10| Human DNA sequence from clone RP11-782C8 on chromosome 1, complete
             sequence
          Length = 175055

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 15775 ctcttctcttcttcttgcct 15794
to top
>emb|BX640538.4| Human DNA sequence from clone RP6-238B6 on chromosome 1, complete
             sequence
          Length = 165731

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 93278 ctcttctcttcttcttgcct 93297
to top
>emb|AL354822.8| Human DNA sequence from clone RP11-474C22 on chromosome 22, complete
             sequence
          Length = 161147

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 87390 ctcttctcttcttcttgcct 87371
to top
>emb|BX572084.5| Human DNA sequence from clone RP11-423O2 on chromosome 1, complete
             sequence
          Length = 186739

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 93359 ctcttctcttcttcttgcct 93340
to top
>dbj|AK100372.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023084G21, full
           insert sequence
          Length = 2284

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 236 tcgaccacgacgggaacccg 255
           ||||||||||||||||||||
Sbjct: 415 tcgaccacgacgggaacccg 434
to top
>emb|AL583842.40| Human DNA sequence from clone RP11-417J8 on chromosome 1, complete
             sequence
          Length = 195588

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 99222 ctcttctcttcttcttgcct 99241
to top
>gb|AE003797.3| Drosophila melanogaster chromosome 2R, section 53 of 73 of the complete
              sequence
          Length = 306854

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 131    actgctcttctcttcttctt 150
              ||||||||||||||||||||
Sbjct: 271059 actgctcttctcttcttctt 271078
to top
>emb|AL137218.5| Human DNA sequence from clone RP11-111E21, complete sequence
          Length = 137718

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 47437 ctcttctcttcttcttgcct 47456
to top
>emb|AL355793.6| Human DNA sequence from clone RP4-694M10 on chromosome 1, complete
             sequence
          Length = 101333

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 22580 ctcttctcttcttcttgcct 22561
to top
>emb|BX004987.9| Human DNA sequence from clone RP11-435B5 on chromosome 1, complete
              sequence
          Length = 201709

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    ctcttctcttcttcttgcct 154
              ||||||||||||||||||||
Sbjct: 114804 ctcttctcttcttcttgcct 114785
to top
>emb|CR974483.16| Mouse DNA sequence from clone RP23-296D10 on chromosome 17, complete
             sequence
          Length = 125345

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   ctgctcttctcttcttcttg 151
             ||||||||||||||||||||
Sbjct: 85730 ctgctcttctcttcttcttg 85749
to top
>emb|AL590523.5| Human DNA sequence from clone RP11-565G5 on chromosome 22, complete
             sequence
          Length = 155397

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 63435 ctcttctcttcttcttgcct 63416
to top
>dbj|AK090412.1| Homo sapiens mRNA for FLJ00310 protein
          Length = 5786

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 135  ctcttctcttcttcttgcct 154
            ||||||||||||||||||||
Sbjct: 4826 ctcttctcttcttcttgcct 4807
to top
>emb|AL355973.21| Human DNA sequence from clone RP4-660N4 on chromosome 1, complete
             sequence
          Length = 110898

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   ctcttctcttcttcttgcct 154
             ||||||||||||||||||||
Sbjct: 68191 ctcttctcttcttcttgcct 68210


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,898,112
Number of Sequences: 3902068
Number of extensions: 2898112
Number of successful extensions: 57082
Number of sequences better than 10.0: 69
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56965
Number of HSP's gapped (non-prelim): 117
length of query: 326
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 304
effective length of database: 17,147,199,772
effective search space: 5212748730688
effective search space used: 5212748730688
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top