>gb|AC008641.7| Homo sapiens chromosome 5 clone CTB-17P3, complete sequence
          Length = 176629

 Score = 44.1 bits (22), Expect = 0.055
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 19    aagattagaagtctttattccc 40
             ||||||||||||||||||||||
Sbjct: 97489 aagattagaagtctttattccc 97468

>gb|AC008666.5|AC008666 Homo sapiens chromosome 5 clone CTB-35A8, complete sequence
          Length = 99108

 Score = 44.1 bits (22), Expect = 0.055
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 19   aagattagaagtctttattccc 40
            ||||||||||||||||||||||
Sbjct: 1414 aagattagaagtctttattccc 1435

>emb|Z98597.1|SPAC17H9 S.pombe chromosome I cosmid c17H9
          Length = 38515

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    gaattgatagaaaacgtta 72
             |||||||||||||||||||
Sbjct: 21498 gaattgatagaaaacgtta 21516

>emb|AL109754.13|HSDJ839B4 Human DNA sequence from clone RP5-839B4 on chromosome 20 Contains the
             3' end of a novel gene, part of a novel gene, the ANKRD5
             gene for ankyrin repeat domain 5 and a CpG island,
             complete sequence
          Length = 165010

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 27    aagtctttattcccctgtt 45
             |||||||||||||||||||
Sbjct: 32872 aagtctttattcccctgtt 32854

>gb|AC010026.7| Drosophila melanogaster 3L BAC RP98-1I24 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 179776

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     agcaaaatcgaaagacaag 21
             |||||||||||||||||||
Sbjct: 45137 agcaaaatcgaaagacaag 45119

>gb|AC011907.4| Drosophila melanogaster 3L BAC RP98-18B21 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 164597

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     agcaaaatcgaaagacaag 21
             |||||||||||||||||||
Sbjct: 31947 agcaaaatcgaaagacaag 31965

>gb|AC182841.2| Pan troglodytes BAC clone CH251-667I24 from chromosome 11, complete
             sequence
          Length = 189657

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 39    ccctgttgagatcaggaat 57
             |||||||||||||||||||
Sbjct: 76922 ccctgttgagatcaggaat 76904

>gb|AC010103.10|AC010103 Homo sapiens clone RP11-508H21, complete sequence
          Length = 194038

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    gattagaagtctttattcc 39
             |||||||||||||||||||
Sbjct: 28974 gattagaagtctttattcc 28956

>gb|AC138674.7| Mus musculus chromosome 7, clone RP23-410I10, complete sequence
          Length = 173504

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 39    ccctgttgagatcaggaat 57
             |||||||||||||||||||
Sbjct: 31203 ccctgttgagatcaggaat 31221

>emb|BX470240.8| Zebrafish DNA sequence from clone CH211-92L17 in linkage group 4,
             complete sequence
          Length = 100845

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     aaatcgaaagacaagatta 25
             |||||||||||||||||||
Sbjct: 10576 aaatcgaaagacaagatta 10594

>gb|AC105165.11| Mus musculus chromosome 18, clone RP24-302C24, complete sequence
          Length = 186431

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 13    aaagacaagattagaagtcttta 35
             |||||||||||||||| ||||||
Sbjct: 63470 aaagacaagattagaaatcttta 63448

>gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 of 83 of the complete
              sequence
          Length = 307657

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 3      agcaaaatcgaaagacaag 21
              |||||||||||||||||||
Sbjct: 197186 agcaaaatcgaaagacaag 197204

>dbj|AP003122.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-313I2, complete
             sequence
          Length = 137888

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 39    ccctgttgagatcaggaat 57
             |||||||||||||||||||
Sbjct: 10452 ccctgttgagatcaggaat 10434

>emb|AL928943.9| Mouse DNA sequence from clone RP23-435J15 on chromosome 2, complete
              sequence
          Length = 160516

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     attagaagtctttattccc 40
              |||||||||||||||||||
Sbjct: 142579 attagaagtctttattccc 142561


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 637,053
Number of Sequences: 3902068
Number of extensions: 637053
Number of successful extensions: 43077
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43058
Number of HSP's gapped (non-prelim): 19
length of query: 82
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 61
effective length of database: 17,151,101,840
effective search space: 1046217212240
effective search space used: 1046217212240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)