ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart52f06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY343330.1| Triticum aestivum ribosomal protein L3 (RPL3) mRNA, RPL3-A1 allele, complete cds Length = 1170 Score = 337 bits (170), Expect = 2e-89 Identities = 200/210 (95%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||| ||||||||||| |||||||||| || || |||||||| |||||||| Sbjct: 1170 ctaagccttgagcctgccgtagaacttctgcttctcgtcagtggtctggaaccggccatg 1111 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1110 cccgaacttggatgaggtgtcgatgaacttgagcttgatctcctcaagggccaaccgcga 1051 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1050 ggtctgcttcaacagggactggcggagggtcaccactctcttcttggggcccacacagca 991 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||||||||||||| Sbjct: 990 gcccttgatcatgaggtagtcacccttcac 961
>gb|AY343327.1| Triticum aestivum ribosomal protein L3 (RPL3) mRNA, RPL3-A1 allele, complete cds Length = 1170 Score = 337 bits (170), Expect = 2e-89 Identities = 200/210 (95%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||| ||||||||||| |||||||||| || || |||||||| |||||||| Sbjct: 1170 ctaagccttgagcctgccgtagaacttctgcttctcgtcagtggtctggaaccggccatg 1111 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1110 cccgaacttggatgaggtgtcgatgaacttgagcttgatctcctcaagggccaaccgcga 1051 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1050 ggtctgcttcaacagggactggcggagggtcaccactctcttcttggggcccacacagca 991 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||||||||||||| Sbjct: 990 gcccttgatcatgaggtagtcacccttcac 961
>gb|AY347531.1| Triticum aestivum cultivar Falat ribosomal protein L3 (RPL3) mRNA, RPL3-A2 allele, complete cds Length = 1170 Score = 321 bits (162), Expect = 9e-85 Identities = 198/210 (94%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||||||||| |||||||||| ||||| |||||||| |||||||| Sbjct: 1170 ctaagccttgagcttgccgtagaacttctgcttctcgtcggtggtctggaaccggccatg 1111 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 || ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1110 cccaaactttgatgaggtgtcgatgaacttgagcttgatctcctcaagggccaaccgcga 1051 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 |||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1050 cgtctgctttaacagggactggcggagggtcaccactctcttcttggggcccacacagca 991 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||||||||||||| Sbjct: 990 gcccttgatcatgaggtagtcacccttcac 961
>gb|AY343328.1| Triticum aestivum ribosomal protein L3 (RPL3) mRNA, RPL3-A2 allele, complete cds Length = 1170 Score = 321 bits (162), Expect = 9e-85 Identities = 198/210 (94%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||||||||| |||||||||| ||||| |||||||| |||||||| Sbjct: 1170 ctaagccttgagcttgccgtagaacttctgcttctcgtcggtggtctggaaccggccatg 1111 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 || ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1110 cccaaactttgatgaggtgtcgatgaacttgagcttgatctcctcaagggccaaccgcga 1051 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 |||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1050 cgtctgctttaacagggactggcggagggtcaccactctcttcttggggcccacacagca 991 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||||||||||||| Sbjct: 990 gcccttgatcatgaggtagtcacccttcac 961
>gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0011J22 map R10571S, complete sequence Length = 154441 Score = 250 bits (126), Expect = 3e-63 Identities = 189/210 (90%) Strand = Plus / Plus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 37785 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 37844 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 37845 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 37904 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 37905 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 37964 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||| |||||||| Sbjct: 37965 acccttgatcatgaggtagtcgcccttcac 37994
>gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0073K23 map near R10571S, complete sequence Length = 161073 Score = 250 bits (126), Expect = 3e-63 Identities = 189/210 (90%) Strand = Plus / Plus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 137086 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 137145 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 137146 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 137205 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 137206 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 137265 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||| |||||||| Sbjct: 137266 acccttgatcatgaggtagtcgcccttcac 137295
>gb|AY257863.1| Oryza sativa (japonica cultivar-group) chromosome 11 genomic sequence Length = 42748 Score = 250 bits (126), Expect = 3e-63 Identities = 189/210 (90%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 31415 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 31356 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 31355 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 31296 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 31295 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 31236 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||| |||||||| Sbjct: 31235 acccttgatcatgaggtagtcgcccttcac 31206
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 250 bits (126), Expect = 3e-63 Identities = 189/210 (90%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 3277200 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 3277141 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 3277140 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 3277081 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 3277080 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 3277021 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||| |||||||| Sbjct: 3277020 acccttgatcatgaggtagtcgcccttcac 3276991
>gb|AF346004.1|AF346004 Lolium perenne L3 ribosomal protein mRNA, partial cds Length = 855 Score = 250 bits (126), Expect = 3e-63 Identities = 210/238 (88%) Strand = Plus / Minus Query: 136 aacactatgggataagatctgtcgcagcctaagccttgagcttgccgtagaacctctgct 195 ||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||| Sbjct: 691 aacactatgggataagatctgcagcagtctaagccttgagcttgccgtagaacttctgct 632 Query: 196 tctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttga 255 |||| ||||| |||||||| || ||||| || ||||||||||||| ||| | ||||| | Sbjct: 631 tctcgtcggtggtctggaatcgaccatgcccaaacttggatgaggggtcaacaaacttaa 572 Query: 256 gcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtca 315 ||||||| ||||| || ||||| || || |||||||||| ||||||||||||||||| | Sbjct: 571 gcttgatctcctcgagagccaagcgggaagtctgcttcaggagggactggcggagggtaa 512 Query: 316 ccaccctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||| ||||| || || ||||||||||||||||||||||||||||| Sbjct: 511 ccaccctcttcttgggccccacacaacaacccttgatcatgaggtagtcacccttcac 454 Score = 77.8 bits (39), Expect = 2e-11 Identities = 89/105 (84%), Gaps = 3/105 (2%) Strand = Plus / Minus Query: 5 caagttcaaaatgcataaaacacgtcagttcaaatattcgcagc---agcagctcagagt 61 |||||||||||| |||||| | | |||||||| || |||||| ||||||||||||| Sbjct: 817 caagttcaaaattcataaacctcaacagttcaaccatccgcagcagtagcagctcagagt 758 Query: 62 tgcaattgcaatgcataaaccggtacccaatcaatctgccacaaa 106 |||||||||||||||||||| |||| || |||||||||||||| Sbjct: 757 ggcaattgcaatgcataaaccagtacaaaaacaatctgccacaaa 713
>dbj|AK101469.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033040J04, full insert sequence Length = 1403 Score = 250 bits (126), Expect = 3e-63 Identities = 189/210 (90%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 1246 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 1187 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 1186 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 1127 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 1126 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 1067 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||| |||||||| Sbjct: 1066 acccttgatcatgaggtagtcgcccttcac 1037
>dbj|AK099225.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094A07, full insert sequence Length = 1433 Score = 250 bits (126), Expect = 3e-63 Identities = 189/210 (90%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 1224 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 1165 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 1164 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 1105 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 1104 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 1045 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||| |||||||| Sbjct: 1044 acccttgatcatgaggtagtcgcccttcac 1015
>dbj|AK073392.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033041E13, full insert sequence Length = 1486 Score = 250 bits (126), Expect = 3e-63 Identities = 189/210 (90%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 1263 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 1204 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 1203 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 1144 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 1143 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 1084 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||| |||||||| Sbjct: 1083 acccttgatcatgaggtagtcgcccttcac 1054
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 250 bits (126), Expect = 3e-63 Identities = 189/210 (90%) Strand = Plus / Minus Query: 164 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 223 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 3285913 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 3285854 Query: 224 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 283 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 3285853 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 3285794 Query: 284 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 343 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 3285793 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 3285734 Query: 344 gcccttgatcatgaggtagtcacccttcac 373 |||||||||||||||||||| |||||||| Sbjct: 3285733 acccttgatcatgaggtagtcgcccttcac 3285704
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 246 bits (124), Expect = 4e-62 Identities = 190/212 (89%) Strand = Plus / Minus Query: 162 gcctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggcca 221 ||||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || Sbjct: 3430583 gcctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccg 3430524 Query: 222 tgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgc 281 || ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | |||| Sbjct: 3430523 tgcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgc 3430464 Query: 282 gaggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcag 341 ||||||||||||| ||| |||||||||||||| || || |||||||| || || |||||| Sbjct: 3430463 gaggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcag 3430404 Query: 342 cagcccttgatcatgaggtagtcacccttcac 373 || |||||||||||||||||||| |||||||| Sbjct: 3430403 caacccttgatcatgaggtagtcgcccttcac 3430372
>dbj|AK060925.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-H11, full insert sequence Length = 1468 Score = 246 bits (124), Expect = 4e-62 Identities = 190/212 (89%) Strand = Plus / Minus Query: 162 gcctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggcca 221 ||||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || Sbjct: 1235 gcctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccg 1176 Query: 222 tgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgc 281 || ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | |||| Sbjct: 1175 tgcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgc 1116 Query: 282 gaggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcag 341 ||||||||||||| ||| |||||||||||||| || || |||||||| || || |||||| Sbjct: 1115 gaggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcag 1056 Query: 342 cagcccttgatcatgaggtagtcacccttcac 373 || |||||||||||||||||||| |||||||| Sbjct: 1055 caacccttgatcatgaggtagtcgcccttcac 1024
>dbj|D12630.1|RICRPL3A Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein L3, complete cds Length = 1368 Score = 246 bits (124), Expect = 4e-62 Identities = 190/212 (89%) Strand = Plus / Minus Query: 162 gcctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggcca 221 ||||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || Sbjct: 1193 gcctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccg 1134 Query: 222 tgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgc 281 || ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | |||| Sbjct: 1133 tgcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgc 1074 Query: 282 gaggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcag 341 ||||||||||||| ||| |||||||||||||| || || |||||||| || || |||||| Sbjct: 1073 gaggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcag 1014 Query: 342 cagcccttgatcatgaggtagtcacccttcac 373 || |||||||||||||||||||| |||||||| Sbjct: 1013 caacccttgatcatgaggtagtcgcccttcac 982
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 246 bits (124), Expect = 4e-62 Identities = 190/212 (89%) Strand = Plus / Minus Query: 162 gcctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggcca 221 ||||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || Sbjct: 3430524 gcctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccg 3430465 Query: 222 tgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgc 281 || ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | |||| Sbjct: 3430464 tgcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgc 3430405 Query: 282 gaggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcag 341 ||||||||||||| ||| |||||||||||||| || || |||||||| || || |||||| Sbjct: 3430404 gaggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcag 3430345 Query: 342 cagcccttgatcatgaggtagtcacccttcac 373 || |||||||||||||||||||| |||||||| Sbjct: 3430344 caacccttgatcatgaggtagtcgcccttcac 3430313
>emb|AL713902.2|CNS07YQ2 Oryza sativa chromosome 12, . BAC OJ1494_F10 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 116371 Score = 246 bits (124), Expect = 4e-62 Identities = 190/212 (89%) Strand = Plus / Plus Query: 162 gcctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggcca 221 ||||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || Sbjct: 101336 gcctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccg 101395 Query: 222 tgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgc 281 || ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | |||| Sbjct: 101396 tgcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgc 101455 Query: 282 gaggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcag 341 ||||||||||||| ||| |||||||||||||| || || |||||||| || || |||||| Sbjct: 101456 gaggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcag 101515 Query: 342 cagcccttgatcatgaggtagtcacccttcac 373 || |||||||||||||||||||| |||||||| Sbjct: 101516 caacccttgatcatgaggtagtcgcccttcac 101547
>emb|AL844874.1|CNS08CAX Oryza sativa chromosome 12, . BAC OSJNBa0041K23 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 137936 Score = 246 bits (124), Expect = 4e-62 Identities = 190/212 (89%) Strand = Plus / Minus Query: 162 gcctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggcca 221 ||||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || Sbjct: 109636 gcctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccg 109577 Query: 222 tgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgc 281 || ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | |||| Sbjct: 109576 tgcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgc 109517 Query: 282 gaggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcag 341 ||||||||||||| ||| |||||||||||||| || || |||||||| || || |||||| Sbjct: 109516 gaggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcag 109457 Query: 342 cagcccttgatcatgaggtagtcacccttcac 373 || |||||||||||||||||||| |||||||| Sbjct: 109456 caacccttgatcatgaggtagtcgcccttcac 109425
>gb|AY347533.1| Triticum aestivum cultivar LI ribosomal protein L3 (RPL3) mRNA, RPL3-B3 allele, complete cds Length = 1170 Score = 238 bits (120), Expect = 1e-59 Identities = 186/208 (89%) Strand = Plus / Minus Query: 166 aagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtc 225 |||||||||||||||||||||||||||||||||| || || ||||||||||| || || | Sbjct: 1168 aagccttgagcttgccgtagaacctctgcttctcgtccgtggtctggaagcgaccgtgcc 1109 Query: 226 cgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgagg 285 |||||||||| |||||||||| ||||||||||||||| ||||| ||||| | || |||| Sbjct: 1108 cgaacttggaagaggtgtcgacgaacttgagcttgatctcctccagggcaagacgagagg 1049 Query: 286 tctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagc 345 ||||||||| |||||||||||||||||||||||| | |||||||||||| || ||||| | Sbjct: 1048 tctgcttcagcagggactggcggagggtcaccacacgcttcttggggccaacacagcatc 989 Query: 346 ccttgatcatgaggtagtcacccttcac 373 |||||||||| ||||||||| ||||||| Sbjct: 988 ccttgatcatcaggtagtcagccttcac 961
>gb|AY347532.1| Triticum aestivum cultivar Falat ribosomal protein L3 (RPL3) mRNA, RPL3-B3 allele, complete cds Length = 1170 Score = 238 bits (120), Expect = 1e-59 Identities = 186/208 (89%) Strand = Plus / Minus Query: 166 aagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtc 225 |||||||||||||||||||||||||||||||||| || || ||||||||||| || || | Sbjct: 1168 aagccttgagcttgccgtagaacctctgcttctcgtccgtggtctggaagcgaccgtgcc 1109 Query: 226 cgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgagg 285 |||||||||| |||||||||| ||||||||||||||| ||||| ||||| | || |||| Sbjct: 1108 cgaacttggaagaggtgtcgacgaacttgagcttgatctcctccagggcaagacgagagg 1049 Query: 286 tctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagc 345 ||||||||| |||||||||||||||||||||||| | |||||||||||| || ||||| | Sbjct: 1048 tctgcttcagcagggactggcggagggtcaccacacgcttcttggggccaacacagcatc 989 Query: 346 ccttgatcatgaggtagtcacccttcac 373 |||||||||| ||||||||| ||||||| Sbjct: 988 ccttgatcatcaggtagtcagccttcac 961
>gb|AY111327.1| Zea mays CL1488_-4 mRNA sequence Length = 615 Score = 236 bits (119), Expect = 4e-59 Identities = 182/203 (89%) Strand = Plus / Minus Query: 168 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 227 |||||||||||||| |||||||||||||||| || || | ||||||||| |||||||| Sbjct: 435 gccttgagcttgccaaagaacctctgcttctcgtctgtggactggaagcgcccatgtcca 376 Query: 228 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 287 |||||||| |||||||||||||||||||||||||| ||||| ||||||||||| || ||| Sbjct: 375 aacttggacgaggtgtcgatgaacttgagcttgatctcctccagggccaaccgagacgtc 316 Query: 288 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 347 ||||||| ||| ||||||||||| ||||||||||| ||||||||||| |||||||| ||| Sbjct: 315 tgcttcagcagagactggcggagagtcaccacccttttcttggggccgacgcagcaaccc 256 Query: 348 ttgatcatgaggtagtcaccctt 370 |||||||| |||||||| ||||| Sbjct: 255 ttgatcatcaggtagtcgccctt 233
>gb|AY103608.1| Zea mays PCO139614 mRNA sequence Length = 1714 Score = 226 bits (114), Expect = 4e-56 Identities = 183/206 (88%) Strand = Plus / Minus Query: 168 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 227 ||||||||||| || |||||||||||||||| ||||| ||||||||||| ||||| || Sbjct: 1291 gccttgagcttaccaaagaacctctgcttctcatcggtagtctggaagcgaccatgccca 1232 Query: 228 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 287 || ||||| || ||||||||||||||||||||||| ||||| || |||| ||| || ||| Sbjct: 1231 aatttggacgatgtgtcgatgaacttgagcttgatctcctccagcgccagccgggaagtc 1172 Query: 288 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 347 ||||||| |||||||||||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 1171 tgcttcaggagggactggcggagggtcaccaccctcttctttggacccacacagcagccc 1112 Query: 348 ttgatcatgaggtagtcacccttcac 373 |||||||| ||||||||||||||||| Sbjct: 1111 ttgatcatcaggtagtcacccttcac 1086
>gb|BT016630.1| Zea mays clone Contig463 mRNA sequence Length = 1432 Score = 210 bits (106), Expect = 2e-51 Identities = 181/206 (87%) Strand = Plus / Minus Query: 168 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 227 ||||||||||| || |||||||||||||||| ||||| ||||||||||| || || || Sbjct: 1227 gccttgagcttaccaaagaacctctgcttctcatcggtagtctggaagcgaccgtgccca 1168 Query: 228 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 287 || ||||| || ||||||||||||||||||||||| ||||| || |||| ||| || ||| Sbjct: 1167 aatttggacgatgtgtcgatgaacttgagcttgatctcctccagcgccagccgggaagtc 1108 Query: 288 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 347 ||||||| |||||||||||||||||||||||||||||||| || ||||| ||||| ||| Sbjct: 1107 tgcttcaggagggactggcggagggtcaccaccctcttctttggacccacacagcatccc 1048 Query: 348 ttgatcatgaggtagtcacccttcac 373 |||||||| ||||||||||||||||| Sbjct: 1047 ttgatcatcaggtagtcacccttcac 1022
>gb|BT016900.1| Zea mays clone Contig733 mRNA sequence Length = 707 Score = 202 bits (102), Expect = 6e-49 Identities = 180/206 (87%) Strand = Plus / Plus Query: 168 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 227 ||||||||||| || |||||||||||||||| ||||| ||||||||||| || || || Sbjct: 471 gccttgagcttaccaaagaacctctgcttctcatcggtagtctggaagcgaccgtgccca 530 Query: 228 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 287 || ||||| || ||||||||||||||||||||||| ||||| || |||| ||| || ||| Sbjct: 531 aatttggacgatgtgtcgatgaacttgagcttgatctcctccagcgccagccgggaagtc 590 Query: 288 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 347 ||||||| |||||||||||||||||||||||||||||||| || ||||| ||||| ||| Sbjct: 591 tgcttcaggagggactggcggagggtcaccaccctcttctttggacccacacagcatccc 650 Query: 348 ttgatcatgaggtagtcacccttcac 373 |||||||| ||| ||||||||||||| Sbjct: 651 ttgatcatcagggagtcacccttcac 676
>gb|BT016883.1| Zea mays clone Contig716 mRNA sequence Length = 569 Score = 186 bits (94), Expect = 3e-44 Identities = 178/206 (86%) Strand = Plus / Plus Query: 168 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 227 ||||||||||| || | |||||||||||||| ||||| ||||||||||| || || || Sbjct: 243 gccttgagcttaccaaaaaacctctgcttctcatcggtagtctggaagcgaccgtgccca 302 Query: 228 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 287 || ||||| || ||||||||||||||||||||||| ||||| || |||| ||| || ||| Sbjct: 303 aatttggacgatgtgtcgatgaacttgagcttgatctcctccagcgccagccgggaagtc 362 Query: 288 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 347 ||||||| |||||||||||||||||||||||||||||||| || ||||| || || ||| Sbjct: 363 tgcttcaggagggactggcggagggtcaccaccctcttctttggacccacacaacatccc 422 Query: 348 ttgatcatgaggtagtcacccttcac 373 |||||||| ||| ||||||||||||| Sbjct: 423 ttgatcatcagggagtcacccttcac 448
>gb|BT017815.1| Zea mays clone EL01N0507E03.c mRNA sequence Length = 1343 Score = 170 bits (86), Expect = 2e-39 Identities = 176/206 (85%) Strand = Plus / Minus Query: 168 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 227 |||||| ||||||| | |||||||||||||| ||||| ||||||||||| || || || Sbjct: 1134 gccttgggcttgccaaaaaacctctgcttctcatcggtagtctggaagcgaccgtgccca 1075 Query: 228 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 287 || ||||| || ||||||||||||||||||||||| ||||| | |||| ||| || ||| Sbjct: 1074 aatttggacgatgtgtcgatgaacttgagcttgatctcctccaacgccagccgggaagtc 1015 Query: 288 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 347 ||||||| ||||||||| |||||||||||||||| || || || ||||| ||||||||| Sbjct: 1014 tgcttcaggagggactgggggagggtcaccacccttttttttggacccacacagcagccc 955 Query: 348 ttgatcatgaggtagtcacccttcac 373 |||||||| ||| ||||||||||||| Sbjct: 954 ttgatcatcagggagtcacccttcac 929
>gb|AY389725.1| Hyacinthus orientalis ribosomal protein L3 mRNA, partial cds Length = 875 Score = 151 bits (76), Expect = 2e-33 Identities = 131/148 (88%), Gaps = 1/148 (0%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||||||||| || || |||||||| ||||||||||||||||||||||| ||| Sbjct: 753 gtctggaagcggccatgacc-aagttggatgatgtgtcgatgaacttgagcttgatttcc 695 Query: 267 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 326 || || ||||| || ||||||||||||| |||||||||||| || || |||||||||||| Sbjct: 694 tccagagccaagcgggaggtctgcttcagcagggactggcgaagcgtgaccaccctcttc 635 Query: 327 ttggggcccacgcagcagcccttgatca 354 |||||||| || ||||| || ||||||| Sbjct: 634 ttggggccaacacagcaaccgttgatca 607
>gb|AY236158.1| Oryza sativa (indica cultivar-group) ribosomal protein L3B mRNA, partial cds Length = 1035 Score = 121 bits (61), Expect = 2e-24 Identities = 91/101 (90%) Strand = Plus / Minus Query: 273 gccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttcttgggg 332 ||||| || ||||||||||| | |||||||||||||||||| || ||||||||||||||| Sbjct: 1028 gccaaacgagaggtctgcttgagcagggactggcggagggtgacgaccctcttcttgggg 969 Query: 333 cccacgcagcagcccttgatcatgaggtagtcacccttcac 373 || || ||||| |||||||||||||||||||| |||||||| Sbjct: 968 ccaacacagcaacccttgatcatgaggtagtcgcccttcac 928
>gb|DQ241849.1| Solanum tuberosum clone 187E04 ribosomal protein L3-like mRNA, complete cds Length = 1434 Score = 111 bits (56), Expect = 2e-21 Identities = 152/184 (82%) Strand = Plus / Minus Query: 190 tctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatga 249 |||||||||||| ||| ||||||||||| |||||||| ||||| || || |||||||||| Sbjct: 1195 tctgcttctcttgggtggtctggaagcgaccatgtccaaactttgaggatgtgtcgatga 1136 Query: 250 acttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggactggcgga 309 |||| ||||| || |||||||| || | || |||||||| || | |||||| || || | Sbjct: 1135 acttcagcttaatctcctcaagagcaacacgagaggtctggttgagcagggattgacgca 1076 Query: 310 gggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtagtcaccct 369 |||| || ||||||||||| || || || ||||| |||||||||| ||||| ||| ||| Sbjct: 1075 gggttacaaccctcttcttaggaccaacacagcatcccttgatcaacaggtaatcatcct 1016 Query: 370 tcac 373 |||| Sbjct: 1015 tcac 1012
>gb|AY395738.1| Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds Length = 1416 Score = 103 bits (52), Expect = 4e-19 Identities = 151/184 (82%) Strand = Plus / Minus Query: 190 tctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatga 249 |||||||||||| || ||||||||||| |||||||| ||||| || || || ||||||| Sbjct: 1197 tctgcttctcttgagtggtctggaagcgaccatgtccaaactttgaggatgtatcgatga 1138 Query: 250 acttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggactggcgga 309 |||| ||||| || |||||||| || | || |||||||| || | ||||||||| || | Sbjct: 1137 acttcagcttaatctcctcaagagcgacacgagaggtctggttgagcagggactgacgaa 1078 Query: 310 gggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtagtcaccct 369 |||| || ||||||||||| || || || ||||| |||||||||| ||||| ||| ||| Sbjct: 1077 gggttacaaccctcttcttaggaccaacacagcatcccttgatcaacaggtaatcatcct 1018 Query: 370 tcac 373 |||| Sbjct: 1017 tcac 1014
>gb|AC150978.15| Medicago truncatula clone mth2-66m17, complete sequence Length = 125121 Score = 97.6 bits (49), Expect = 2e-17 Identities = 142/173 (82%) Strand = Plus / Minus Query: 183 tagaacctctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtg 242 |||||| | ||||||||| ||||||||||| || |||||||| |||||||| ||||| Sbjct: 9347 tagaacttttgcttctctgatgttgtctggaaacgaccatgtccaaacttggaagaggta 9288 Query: 243 tcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggac 302 ||||| |||||||| |||||||||||||| || | || || |||||||| | |||||| Sbjct: 9287 tcgataaacttgagtttgatatcctcaagagcaagacgagaagtctgcttaagaagggac 9228 Query: 303 tggcggagggtcaccaccctcttcttggggcccacgcagcagcccttgatcat 355 ||||| || || | |||||||||||||| || || |||| ||||||||||| Sbjct: 9227 tggcgcagagtaataaccctcttcttgggaccaacacagcctcccttgatcat 9175
>gb|AC125473.12| Medicago truncatula clone mth2-8j13, complete sequence Length = 103966 Score = 97.6 bits (49), Expect = 2e-17 Identities = 142/173 (82%) Strand = Plus / Plus Query: 183 tagaacctctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtg 242 |||||| | ||||||||| ||||||||||| || |||||||| |||||||| ||||| Sbjct: 12 tagaacttttgcttctctgatgttgtctggaaacgaccatgtccaaacttggaagaggta 71 Query: 243 tcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggac 302 ||||| |||||||| |||||||||||||| || | || || |||||||| | |||||| Sbjct: 72 tcgataaacttgagtttgatatcctcaagagcaagacgagaagtctgcttaagaagggac 131 Query: 303 tggcggagggtcaccaccctcttcttggggcccacgcagcagcccttgatcat 355 ||||| || || | |||||||||||||| || || |||| ||||||||||| Sbjct: 132 tggcgcagagtaataaccctcttcttgggaccaacacagcctcccttgatcat 184
>gb|AC126014.6| Medicago truncatula clone mth2-18j5, complete sequence Length = 113200 Score = 97.6 bits (49), Expect = 2e-17 Identities = 142/173 (82%) Strand = Plus / Minus Query: 183 tagaacctctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtg 242 |||||| | ||||||||| ||||||||||| || |||||||| |||||||| ||||| Sbjct: 99627 tagaacttttgcttctctgatgttgtctggaaacgaccatgtccaaacttggaagaggta 99568 Query: 243 tcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggac 302 ||||| |||||||| |||||||||||||| || | || || |||||||| | |||||| Sbjct: 99567 tcgataaacttgagtttgatatcctcaagagcaagacgagaagtctgcttaagaagggac 99508 Query: 303 tggcggagggtcaccaccctcttcttggggcccacgcagcagcccttgatcat 355 ||||| || || | |||||||||||||| || || |||| ||||||||||| Sbjct: 99507 tggcgcagagtaataaccctcttcttgggaccaacacagcctcccttgatcat 99455
>gb|AY456411.1| Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds Length = 1387 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 190 tctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatga 249 |||||||||||| ||| ||||||||||| |||||||| |||||||| || |||||||||| Sbjct: 1178 tctgcttctcttgggtggtctggaagcgaccatgtccaaacttggaggatgtgtcgatga 1119 Query: 250 acttgagcttgatatcctcaag 271 |||| ||||| || |||||||| Sbjct: 1118 acttcagcttaatctcctcaag 1097
>emb|Y14339.1|LEY14339 Lycopersicon esculentum mRNA for proteasome, alpha subunit Length = 1686 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 190 tctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatga 249 |||||||||||| ||| ||||||||||| |||||||| |||||||| || |||||||||| Sbjct: 1453 tctgcttctcttgggtggtctggaagcgaccatgtccaaacttggaggatgtgtcgatga 1394 Query: 250 acttgagcttgatatcctcaag 271 |||| ||||| || |||||||| Sbjct: 1393 acttcagcttaatctcctcaag 1372
>emb|AJ248327.1|MSA248327 Medicago sativa subsp. X varia mRNA for L3 Ribosomal protein Length = 1201 Score = 87.7 bits (44), Expect = 2e-14 Identities = 125/152 (82%) Strand = Plus / Minus Query: 204 gttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgata 263 ||||||||||| || |||||||| |||||| | ||||| ||||| |||||||| |||||| Sbjct: 1151 gttgtctggaaacgaccatgtccaaacttgaaagaggtatcgataaacttgagtttgata 1092 Query: 264 tcctcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctc 323 |||||||| || | || || |||||||| | ||||||||||| || || | |||||| Sbjct: 1091 tcctcaagagcaagacgagaagtctgcttaagaagggactggcgcagagtaataaccctc 1032 Query: 324 ttcttggggcccacgcagcagcccttgatcat 355 |||||||| || || |||| ||||||||||| Sbjct: 1031 ttcttgggaccaacacagcctcccttgatcat 1000
>gb|BT011339.1| Drosophila melanogaster RH62603 full insert cDNA Length = 1396 Score = 85.7 bits (43), Expect = 9e-14 Identities = 124/151 (82%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1176 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1117 Query: 267 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 326 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1116 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1057 Query: 327 ttggggcccacgcagcagcccttgatcatga 357 |||| ||| | |||||||||||||||||||| Sbjct: 1056 ttggagccgatgcagcagcccttgatcatga 1026
>ref|NM_169379.1| Drosophila melanogaster Ribosomal protein L3 CG4863-RE, transcript variant E (RpL3), mRNA Length = 1829 Score = 85.7 bits (43), Expect = 9e-14 Identities = 124/151 (82%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1395 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1336 Query: 267 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 326 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1335 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1276 Query: 327 ttggggcccacgcagcagcccttgatcatga 357 |||| ||| | |||||||||||||||||||| Sbjct: 1275 ttggagccgatgcagcagcccttgatcatga 1245
>ref|NM_169378.1| Drosophila melanogaster Ribosomal protein L3 CG4863-RB, transcript variant B (RpL3), mRNA Length = 1579 Score = 85.7 bits (43), Expect = 9e-14 Identities = 124/151 (82%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1145 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1086 Query: 267 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 326 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1085 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1026 Query: 327 ttggggcccacgcagcagcccttgatcatga 357 |||| ||| | |||||||||||||||||||| Sbjct: 1025 ttggagccgatgcagcagcccttgatcatga 995
>ref|NM_079592.2| Drosophila melanogaster Ribosomal protein L3 CG4863-RA, transcript variant A (RpL3), mRNA Length = 1610 Score = 85.7 bits (43), Expect = 9e-14 Identities = 124/151 (82%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1176 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1117 Query: 267 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 326 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1116 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1057 Query: 327 ttggggcccacgcagcagcccttgatcatga 357 |||| ||| | |||||||||||||||||||| Sbjct: 1056 ttggagccgatgcagcagcccttgatcatga 1026
>gb|AC006491.24|AC006491 Drosophila melanogaster, chromosome 3R, region 86D1-86E1, BAC clone BACR48M21, complete sequence Length = 164386 Score = 85.7 bits (43), Expect = 9e-14 Identities = 124/151 (82%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 113227 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 113168 Query: 267 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 326 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 113167 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 113108 Query: 327 ttggggcccacgcagcagcccttgatcatga 357 |||| ||| | |||||||||||||||||||| Sbjct: 113107 ttggagccgatgcagcagcccttgatcatga 113077
>gb|AE003690.3| Drosophila melanogaster chromosome 3R, section 28 of 118 of the complete sequence Length = 170298 Score = 85.7 bits (43), Expect = 9e-14 Identities = 124/151 (82%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 138452 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 138393 Query: 267 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 326 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 138392 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 138333 Query: 327 ttggggcccacgcagcagcccttgatcatga 357 |||| ||| | |||||||||||||||||||| Sbjct: 138332 ttggagccgatgcagcagcccttgatcatga 138302
>gb|AF016835.1|AF016835 Drosophila melanogaster ribosomal protein L3 (RpL3) mRNA, complete cds Length = 1381 Score = 85.7 bits (43), Expect = 9e-14 Identities = 124/151 (82%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1175 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1116 Query: 267 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 326 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1115 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1056 Query: 327 ttggggcccacgcagcagcccttgatcatga 357 |||| ||| | |||||||||||||||||||| Sbjct: 1055 ttggagccgatgcagcagcccttgatcatga 1025
>ref|XM_547185.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L3-like (LOC490065), mRNA Length = 1733 Score = 83.8 bits (42), Expect = 4e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || ||||||||||||||| || || |||||||| | ||||||||||||||| Sbjct: 1416 cttctcttgggctgtctggaagcggccgtggccaaacttggaggtggtgtcgatgaactt 1357 Query: 254 gagcttgatatcctcaagggcc 275 ||||| ||||| ||| |||||| Sbjct: 1356 gagctcgatattctccagggcc 1335
>gb|AC005606.3| Homo sapiens chromosome 16, P1 clone 109-8C (LANL), complete sequence Length = 80662 Score = 81.8 bits (41), Expect = 1e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 4608 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 4667 Query: 254 gagct 258 ||||| Sbjct: 4668 gagct 4672
>gb|AC005363.1| Homo sapiens chromosome 16, P1 clone 47-2H (LANL), complete sequence Length = 75108 Score = 81.8 bits (41), Expect = 1e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 47195 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 47254 Query: 254 gagct 258 ||||| Sbjct: 47255 gagct 47259
>ref|NM_005061.2| Homo sapiens ribosomal protein L3-like (RPL3L), mRNA Length = 1547 Score = 81.8 bits (41), Expect = 1e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 1202 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 1143 Query: 254 gagct 258 ||||| Sbjct: 1142 gagct 1138
>gb|AE006640.1| Homo sapiens 16p13.3 sequence section 8 of 8 Length = 81579 Score = 81.8 bits (41), Expect = 1e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 67254 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 67313 Query: 254 gagct 258 ||||| Sbjct: 67314 gagct 67318
>gb|BC050413.1| Homo sapiens ribosomal protein L3-like, mRNA (cDNA clone MGC:54082 IMAGE:6204847), complete cds Length = 2142 Score = 81.8 bits (41), Expect = 1e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 1194 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 1135 Query: 254 gagct 258 ||||| Sbjct: 1134 gagct 1130
>gb|U65581.1|HSU65581 Human ribosomal protein L3-like mRNA, complete cds Length = 1548 Score = 81.8 bits (41), Expect = 1e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 1203 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 1144 Query: 254 gagct 258 ||||| Sbjct: 1143 gagct 1139
>emb|AL499629.1| Human DNA sequence from clone XX-PAC76P10 on chromosome 16, complete sequence Length = 26689 Score = 81.8 bits (41), Expect = 1e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 11761 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 11820 Query: 254 gagct 258 ||||| Sbjct: 11821 gagct 11825
>gb|BC103272.1| Bos taurus ribosomal protein L3-like, mRNA (cDNA clone MGC:128622 IMAGE:7986314), complete cds Length = 1342 Score = 75.8 bits (38), Expect = 9e-11 Identities = 71/82 (86%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || |||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1175 cttctcttgggctgtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1116 Query: 254 gagcttgatatcctcaagggcc 275 ||||| ||| | ||| |||||| Sbjct: 1115 gagctcgatgttctccagggcc 1094
>ref|NM_001035501.1| Bos taurus ribosomal protein L3-like (RPL3L), mRNA Length = 1342 Score = 75.8 bits (38), Expect = 9e-11 Identities = 71/82 (86%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||| || |||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1175 cttctcttgggctgtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1116 Query: 254 gagcttgatatcctcaagggcc 275 ||||| ||| | ||| |||||| Sbjct: 1115 gagctcgatgttctccagggcc 1094
>gb|AY395739.1| Nicotiana tabacum ribosomal protein L3B (RPL3B) mRNA, complete cds Length = 1487 Score = 67.9 bits (34), Expect = 2e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| ||||| || |||||||| || ||||| ||||||||||||||||| ||| Sbjct: 1255 gtctggaagcgtccatggccaaacttggaggatgtgtcaatgaacttgagcttgatctcc 1196 Query: 267 tc 268 || Sbjct: 1195 tc 1194
>gb|AY072287.1| Spodoptera frugiperda ribosomal protein L3 mRNA, complete cds Length = 1380 Score = 65.9 bits (33), Expect = 9e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| ||||| ||||||||||| || |||||||||||||| || ||||| | | Sbjct: 1169 gtctggaagcgaccatgaccgaacttggacgatgtgtcgatgaacttaagattgatcttc 1110 Query: 267 tcaag 271 ||||| Sbjct: 1109 tcaag 1105
>dbj|AB008848.1| Cucumis sativus Csf-3 mRNA, complete cds Length = 911 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 204 gttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgata 263 |||||||||||||| ||||| || |||||||| || || ||||||||||| || ||||| Sbjct: 707 gttgtctggaagcgtccatggccaaacttggaggatgtatcgatgaacttaagtttgatc 648 Query: 264 tcctcaagggcca 276 |||||||| |||| Sbjct: 647 tcctcaagagcca 635
>gb|DQ440217.1| Aedes aegypti clone AET-2405 ribosomal protein L3 mRNA, complete cds Length = 1248 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| |||||||| | ||| || |||||||||||||||||||| ||||| Sbjct: 1142 gtctggaagcgaccatgtcccatcttcgacgaggtgtcgatgaacttgaggttgat 1087
>gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic sequence Length = 363675 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 110846 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 110905
>gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic sequence Length = 336776 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 89950 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 90009
>emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chromosome 6, complete sequence Length = 116320 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 18173 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 18114
>emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chromosome 6 Contains the USP8P pseudogene for ubiquitin specific protease 8, the RPL3P2 pseudogene for ribosomal protein L3 pseudogene 2, the WASF5P pseudogene for WAS protein family, member 5, the HLA-B gene for major histocompatibility complex, class I, B, the DHFRP2 pseudogene for dihydrofolate reductase 2, the FGFR3P pseudogene for fibroblast growth factor receptor 3, the HLA-S gene for major histocompatibility complex, class I, S, the MICA gene for MHC class I polypeptide-related sequence A and 3 CpG islands, complete sequence Length = 148076 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 9600 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 9541
>emb|BX070229.1|CNS09QCP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 494 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 382 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 437
>emb|BX069091.1|CNS09PH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 719 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 370 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 425
>emb|BX067464.1|CNS09O7W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 732 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 368 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 423
>emb|BX066688.1|CNS09NMC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 733 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX063181.1|CNS09KWX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 498 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 390 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 445
>emb|BX062383.1|CNS09KAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 473 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 358 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 413
>emb|BX062239.1|CNS09K6R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1023 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 367 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 422
>emb|BX060194.1|CNS09ILY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 814 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 376 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 431
>emb|BX058958.1|CNS09HNM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 354 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 409
>emb|BX057772.1|CNS09GQO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 366 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 421
>emb|BX057771.1|CNS09GQN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 549 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 494
>emb|BX053703.1|CNS09DLN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 813 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 384 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 439
>emb|BX052320.1|CNS09CJ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 823 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 383 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 438
>emb|BX052207.1|CNS09CG3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 365 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 420
>emb|BX051342.1|CNS09BS2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC28CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 505 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 381 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 436
>emb|BX047013.1|CNS098FT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21AA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 412 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 102 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 157
>emb|BX045562.1|CNS097BI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC19DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 358 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 413
>emb|BX042075.1|CNS094MN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 361 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 416
>emb|BX041788.1|CNS094EO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13BG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 452 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 376 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 431
>emb|BX041879.1|CNS094H7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 394 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 449
>emb|BX040939.1|CNS093R3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 380 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 435
>emb|BX040435.1|CNS093D3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC11BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 502 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 347 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 402
>emb|BX040075.1|CNS09333 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 365 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 420
>emb|BX039982.1|CNS0930I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 880 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 375 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 430
>emb|BX039400.1|CNS092KC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC1AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 366 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 421
>emb|BX037369.1|CNS090ZX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 354 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 409
>emb|BX036641.1|CNS090FP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 738 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 149 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 204
>emb|BX036928.1|CNS090NO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9AF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 798 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX035976.1|CNS08ZX8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 371 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 426
>emb|BX034744.1|CNS08YZ0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 817 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 368 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 423
>emb|BX034675.1|CNS08YX3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 439 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 342 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 397
>emb|BX034953.1|CNS08Z4T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 366 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 421
>emb|BX034935.1|CNS08Z4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 399 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 454
>emb|BX034934.1|CNS08Z4A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 853 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 683 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 628
>emb|BX034893.1|CNS08Z35 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 441 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 368 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 423
>emb|BX034597.1|CNS08YUX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 460 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 344 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 399
>emb|BX033937.1|CNS08YCL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 380 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 435
>emb|BX033936.1|CNS08YCK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1038 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 977 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 922
>emb|BX033914.1|CNS08YBY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5CD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 793 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 394 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 449
>emb|BX033913.1|CNS08YBX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5CD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 958 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 903
>emb|BX032095.1|CNS08WXF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 365 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 420
>emb|BX030105.1|CNS08VE5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 378 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 433
>emb|BX029793.1|CNS08V5H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 503 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 395 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 450
>emb|BX028838.1|CNS08UEY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA43AC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 368 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 423
>emb|BX022368.1|CNS08PF8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 400 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 455
>emb|BX028315.1|CNS08U0F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42BC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 783 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 281 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 336
>emb|BX028101.1|CNS08TUH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 387 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 442
>emb|BX026943.1|CNS08SYB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 387 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 442
>emb|BX026942.1|CNS08SYA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA40BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1034 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 958 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 903
>emb|BX025362.1|CNS08RQE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 381 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 436
>emb|BX022756.1|CNS08PQ0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 445 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 365 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 420
>emb|BX023768.1|CNS08QI4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36BB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 381 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 436
>emb|BX023517.1|CNS08QB5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 782 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 406 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 461
>emb|BX022149.1|CNS08P95 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1020 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 856 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 801
>emb|BX020590.1|CNS08O1U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 142 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 68 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 123
>emb|BX016154.1|CNS08KMM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24AH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 803 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 377 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 432
>emb|BX014588.1|CNS08JF4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA21DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 802 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX013163.1|CNS08IBJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2DD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 669 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 376 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 431
>emb|BX012542.1|CNS08HUA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA19DF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 376 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 431
>emb|BX011336.1|CNS08GWS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA18AE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 377 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 432
>emb|BX011335.1|CNS08GWR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA18AE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 973 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 918
>emb|BX009748.1|CNS08FOO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 876 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 366 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 421
>emb|BX008998.1|CNS08F3U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA14CG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcctatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX008818.1|CNS08EYU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA14BF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 385 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 440
>emb|BX008450.1|CNS08EOM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA13DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 358 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 413
>emb|BX007553.1|CNS08DZP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA12CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 803 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 384 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 439
>emb|BX006242.1|CNS08CZA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA10CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 383 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 438
>emb|BX006017.1|CNS08CT1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA10BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1015 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 386 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 441
>emb|BX006005.1|CNS08CSP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA10BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 864 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX005636.1|CNS08CIG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA1AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>gb|AC103565.1| Caenorhabditis briggsae cosmid CB019K16, complete sequence Length = 84313 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||||||| |||||||||||||||||| ||||||| ||||| Sbjct: 10218 gtctggaagcgaccatgtccggtcttggatgaggtgtcgatccacttgaggttgat 10273
>ref|XM_313303.2| Anopheles gambiae str. PEST ENSANGP00000011028 (ENSANGG00000008539), partial mRNA Length = 1257 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 1193 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 1138
>gb|AC004204.1|AC004204 Homo sapiens clone UWGC:y3c018 from 6p21, complete sequence Length = 46797 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 20416 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 20475
>emb|BX064127.1|CNS09LN7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 456 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttga 261 ||||||||||| ||||| || | ||| || ||||||||||||||||||||||||| Sbjct: 363 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttga 417
>emb|BX022547.1|CNS08PK7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 477 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttga 261 ||||||||||| ||||| || | ||| || ||||||||||||||||||||||||| Sbjct: 362 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttga 416
>emb|BX019299.1|CNS08N1Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA29BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 208 tctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 |||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 357 tctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 411
>dbj|AB243054.1| Oncorhynchus mykiss mRNA for sex hormone-binding globulin, complete cds Length = 3485 Score = 61.9 bits (31), Expect = 1e-06 Identities = 46/51 (90%) Strand = Plus / Plus Query: 206 tgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgag 256 ||||||||||||||| || || |||||||| | |||||||||||||||||| Sbjct: 154 tgtctggaagcggccgtggccaaacttggaggtggtgtcgatgaacttgag 204
>dbj|AK109100.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-B01, full insert sequence Length = 1470 Score = 60.0 bits (30), Expect = 5e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 266 ||||||||||| || || |||||||||||||| ||||| | |||||||||||||| ||| Sbjct: 1165 gtctggaagcgaccgtggccgaacttggatgatgtgtccacaaacttgagcttgatctcc 1106 Query: 267 tc 268 || Sbjct: 1105 tc 1104 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 345 cccttgatcatgaggtagtc 364 |||||||||||||||||||| Sbjct: 1027 cccttgatcatgaggtagtc 1008
>gb|DQ206600.1| Monosiga brevicollis isolate TOA20 ribosomal protein 3 large subunit mRNA, partial cds Length = 995 Score = 60.0 bits (30), Expect = 5e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgag 256 ||||||||||| || || || |||||||| |||||||||||||||||||| Sbjct: 995 gtctggaagcgaccgtggccaaacttggacgaggtgtcgatgaacttgag 946
>ref|NM_001001590.1| Danio rerio ribosomal protein L3 (rpl3), mRNA Length = 1371 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||||| | |||||||| || ||||| || |||||||| | ||||||||||||||| Sbjct: 1236 cttctcttcgatggtctggaaacgtccatgaccaaacttggaggtggtgtcgatgaactt 1177
>gb|AY769270.1| Bombyx mori ribosomal protein L3 (RpL3) mRNA, complete cds Length = 1298 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 |||||||| || ||||| ||||||||||| |||||||| ||||| ||||| ||||| Sbjct: 1145 gtctggaatcgaccatgaccgaacttggacgaggtgtcaatgaatttgaggttgat 1090
>gb|AY439445.1| Armigeres subalbatus ASAP ID: 39847 cytosolic large ribosomal subunit L3 mRNA sequence Length = 912 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||| ||| |||||||| | ||| || |||||||||||||||||||| ||||| Sbjct: 717 gtctggaggcgaccatgtcccatctttgacgaggtgtcgatgaacttgaggttgat 662
>gb|AY561514.1| Danio rerio ribosomal protein L3 (rpl3) mRNA, complete cds Length = 1371 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||||| | |||||||| || ||||| || |||||||| | ||||||||||||||| Sbjct: 1236 cttctcttcgatggtctggaaacgtccatgaccaaacttggaggtggtgtcgatgaactt 1177
>emb|AM048987.1| Scarabaeus laticollis mRNA for ribosomal protein L3e (rpL3e gene) Length = 1233 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 |||||||| | |||||| |||||||| ||||| |||||||||||||| || ||||| Sbjct: 1142 gtctggaacctgccatggccgaacttcgatgacgtgtcgatgaacttcaggttgat 1087
>gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001/HLA-Cw0602 genomic sequence Length = 346809 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 96129 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 96188
>gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B570101/HLA-Cw0602 genomic sequence Length = 265420 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 99288 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 99347
>gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B15010101/HLA-Cw030401 genomic sequence Length = 351341 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 110921 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 110980
>emb|BX070444.1|CNS09QIO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| | ||| || | ||| || |||||||||||||||||||||||||| Sbjct: 374 gtctggaagcgacgatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 429
>emb|BX070319.1|CNS09QF7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 849 Score = 56.0 bits (28), Expect = 8e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagct 258 ||||||||||| ||||| || | ||| || |||||||||||||||||||||| Sbjct: 239 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagct 188
>emb|BX056851.1|CNS09G13 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 415 Score = 56.0 bits (28), Expect = 8e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagct 258 ||||||||||| ||||| || | ||| || |||||||||||||||||||||| Sbjct: 231 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagct 180
>emb|BX050764.1|CNS09BC0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 843 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||||||||||||||||| ||||| Sbjct: 361 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagtttgat 416
>emb|BX012729.1|CNS08HZH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | || || |||||||||||||||||||||||||| Sbjct: 403 gtctggaagcgaccatggcccattttcgacgaggtgtcgatgaacttgagcttgat 458
>emb|BX011527.1|CNS08H23 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA18BG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 262 ||||||||||| ||||| || | ||| || |||||| ||||||||||||||||||| Sbjct: 361 gtctggaagcgaccatggcccatcttcgacgaggtgccgatgaacttgagcttgat 416
>emb|BX901883.5| Zebrafish DNA sequence from clone DKEY-151M15 in linkage group 3, complete sequence Length = 241961 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||||| | |||||||| || ||||| || |||||||| | ||||||||||||||| Sbjct: 170096 cttctcttcgatggtctggaaacgtccatgaccaaacttggaggtggtgtcgatgaactt 170155
>emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chromosome 6, complete sequence Length = 102821 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 20109 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 20050
>emb|CR759814.6| Human DNA sequence from clone DADB-15N24 on chromosome 6, complete sequence Length = 63499 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 2029 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 1970
>dbj|AB169493.1| Macaca fascicularis brain cDNA, clone: QccE-11024, similar to human ribosomal protein L3 (RPL3), mRNA, RefSeq: NM_000967.2 Length = 1310 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||| | ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1182 cttctcttccatggtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1123
>gb|BC091460.1| Danio rerio ribosomal protein L3, mRNA (cDNA clone MGC:110350 IMAGE:7403740), complete cds Length = 1324 Score = 56.0 bits (28), Expect = 8e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 194 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 |||||||||| | |||||||| || ||||| || |||||||| | ||||||||||||||| Sbjct: 1178 cttctcttcgatggtctggaaacgtccatgaccaaacttggaggtggtgtcgatgaactt 1119
>gb|BC088373.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:111436 IMAGE:6195715), complete cds Length = 1305 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1165 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1119
>gb|BC107711.1| Homo sapiens ribosomal protein L3, transcript variant 1, mRNA (cDNA clone MGC:104284 IMAGE:6699816), complete cds Length = 1325 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1172 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1126
>ref|XM_525601.1| PREDICTED: Pan troglodytes similar to ribosomal protein L3; 60S ribosomal protein L3; HIV-1 TAR RNA-binding protein B (LOC470216), mRNA Length = 2523 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1181 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1135
>gb|BC012786.2| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:16463 IMAGE:3951917), complete cds Length = 1323 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1155 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1109
>gb|BC058494.1| Rattus norvegicus ribosomal protein L3, mRNA (cDNA clone MGC:72934 IMAGE:6887923), complete cds Length = 1320 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||| ||||||||||| ||||| | |||||| |||||||| Sbjct: 1171 gtctggaagcgaccatgtccgaatttggaggtggtgtcaatgaactt 1125
>gb|BC063662.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:70878 IMAGE:3852576), complete cds Length = 1299 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1155 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1109
>gb|BC015767.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:23196 IMAGE:4861546), complete cds Length = 1295 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1151 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1105
>gb|BC013674.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:17324 IMAGE:4152521), complete cds Length = 1317 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1151 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1105
>gb|BC008492.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:14821 IMAGE:4251511), complete cds Length = 1322 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1168 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1122
>gb|BC008003.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:15830 IMAGE:3507481), complete cds Length = 1291 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1147 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1101
>gb|BC033296.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone IMAGE:4510463), partial cds Length = 1299 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1148 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1102
>gb|BC004323.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone IMAGE:3628762), partial cds Length = 952 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 809 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 763
>gb|BC012146.1| Homo sapiens ribosomal protein L3, transcript variant 1, mRNA (cDNA clone MGC:20359 IMAGE:4549682), complete cds Length = 1298 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1155 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1109
>gb|BC017593.1| Homo sapiens cDNA clone IMAGE:2988782, **** WARNING: chimeric clone **** Length = 3547 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 3404 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 3358
>gb|BC041578.1| Homo sapiens zinc finger protein 114, mRNA (cDNA clone IMAGE:4640152), **** WARNING: chimeric clone **** Length = 3538 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 3395 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 3349
>emb|AL022326.1|HS333H23 Human DNA sequence from clone RP3-333H23 on chromosome 22q12.1-12.3 Contains the (possibly alternatively spliced) RPL3 gene for 60S Ribosomal Protein L3 and the threefold alternatively spliced gene for Synaptogyrin 1A, 1B and 1C (SYNGR1A, SYBGRIB, SYNGR1C), both genes downstream of a putative CpG island. Contains ESTs, an STS, GSSs, and a ca repeat (D22S1155) polymorphism, complete sequence Length = 122888 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 46253 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 46299
>gb|AY320405.1| Homo sapiens nasopharyngeal carcinoma-associated antigen NPC-A-12 mRNA, complete cds Length = 1414 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1289 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1243
>emb|X73460.1|HSRPL3A H.sapiens mRNA for ribosomal protein L3 Length = 1272 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1148 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1102
>emb|X62166.1|RRRPL3 R.rattus mRNA for ribosomal protein L3 Length = 1316 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||| ||||||||||| ||||| | |||||| |||||||| Sbjct: 1172 gtctggaagcgaccatgtccgaatttggaggtggtgtcaatgaactt 1126
>gb|BC036582.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:42068 IMAGE:4796724), complete cds Length = 2127 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1987 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1941
>emb|CR926481.1| Pongo pygmaeus mRNA; cDNA DKFZp468G0827 (from clone DKFZp468G0827) Length = 1932 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1786 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1740
>gb|BC014017.2| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:20304 IMAGE:4128023), complete cds Length = 1311 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1150 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1104
>emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chromosome 6, complete sequence Length = 106199 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 20680 gtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 20634
>gb|BC006483.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone IMAGE:2905497), complete cds Length = 1304 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1155 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1109
>emb|CR615684.1| full-length cDNA clone CS0DG004YH06 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1230 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1119 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1073
>emb|AL832757.1|HSM804068 Homo sapiens mRNA; cDNA DKFZp686B0827 (from clone DKFZp686B0827) Length = 5458 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 5107 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 5061
>emb|CR626505.1| full-length cDNA clone CS0DJ010YA12 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1251 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR626451.1| full-length cDNA clone CS0DA008YH04 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR626261.1| full-length cDNA clone CS0DF015YH20 of Fetal brain of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR625577.1| full-length cDNA clone CS0DI063YL04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1234 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR625496.1| full-length cDNA clone CS0DI084YC13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR625393.1| full-length cDNA clone CS0DI003YJ22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1213 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR625263.1| full-length cDNA clone CL0BB015ZB11 of Neuroblastoma of Homo sapiens (human) Length = 760 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 634 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 588
>emb|CR624992.1| full-length cDNA clone CL0BB016ZB06 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR623791.1| full-length cDNA clone CS0DM002YH24 of Fetal liver of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR623564.1| full-length cDNA clone CS0DI019YJ17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1353 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1320 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1274
>emb|CR622788.1| full-length cDNA clone CS0DJ013YE08 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR621566.1| full-length cDNA clone CL0BB003ZH08 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR621265.1| full-length cDNA clone CS0DA008YD14 of Neuroblastoma of Homo sapiens (human) Length = 1227 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1102 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1056
>emb|CR620145.1| full-length cDNA clone CS0DI057YK20 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1236 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR619471.1| full-length cDNA clone CS0DH005YK18 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1264 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR619715.1| full-length cDNA clone CS0DH003YK05 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1269 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR619632.1| full-length cDNA clone CS0DF020YI04 of Fetal brain of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR619057.1| full-length cDNA clone CS0DA001YB02 of Neuroblastoma of Homo sapiens (human) Length = 904 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 778 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 732
>emb|CR617467.1| full-length cDNA clone CL0BB009ZB12 of Neuroblastoma of Homo sapiens (human) Length = 1264 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR617147.1| full-length cDNA clone CS0DI072YC22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1228 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR616770.1| full-length cDNA clone CS0DA001YA11 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR616722.1| full-length cDNA clone CS0DI084YN09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR615390.1| full-length cDNA clone CL0BB025ZG06 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR613925.1| full-length cDNA clone CL0BB014ZD01 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR609557.1| full-length cDNA clone CS0DE007YI06 of Placenta of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR612896.1| full-length cDNA clone CS0DA004YC12 of Neuroblastoma of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR612782.1| full-length cDNA clone CS0DA007YN20 of Neuroblastoma of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR612126.1| full-length cDNA clone CS0DM006YJ05 of Fetal liver of Homo sapiens (human) Length = 849 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 723 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 677
>emb|CR611722.1| full-length cDNA clone CS0DK002YP16 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 254 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 128 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 82
>emb|CR610441.1| full-length cDNA clone CS0DH006YF09 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 949 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 823 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 777
>emb|CR608886.1| full-length cDNA clone CS0DH007YL14 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>dbj|AK092695.1| Homo sapiens cDNA FLJ35376 fis, clone SKMUS2004044, highly similar to 60S RIBOSOMAL PROTEIN L3 Length = 1160 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1021 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 975
>emb|CR608723.1| full-length cDNA clone CS0DN004YH20 of Adult brain of Homo sapiens (human) Length = 1226 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR607725.1| full-length cDNA clone CS0DI070YF03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR607164.1| full-length cDNA clone CS0DK005YF16 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1267 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR605080.1| full-length cDNA clone CS0DI031YB01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1233 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR605015.1| full-length cDNA clone CS0DF024YK22 of Fetal brain of Homo sapiens (human) Length = 1216 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR605531.1| full-length cDNA clone CL0BB009ZC01 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR604030.1| full-length cDNA clone CS0DE014YE11 of Placenta of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR602004.1| full-length cDNA clone CS0DH005YI17 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR601663.1| full-length cDNA clone CS0DF008YN16 of Fetal brain of Homo sapiens (human) Length = 1243 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR601581.1| full-length cDNA clone CS0DI053YP13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1212 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR601189.1| full-length cDNA clone CS0DE009YE21 of Placenta of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR599095.1| full-length cDNA clone CS0DH003YB10 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1269 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597745.1| full-length cDNA clone CS0DI076YC23 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1236 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597737.1| full-length cDNA clone CS0DI083YH07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1229 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597498.1| full-length cDNA clone CS0DN005YH11 of Adult brain of Homo sapiens (human) Length = 1253 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597485.1| full-length cDNA clone CS0DI027YH23 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597097.1| full-length cDNA clone CS0DK006YJ04 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR596802.1| full-length cDNA clone CS0DA001YE02 of Neuroblastoma of Homo sapiens (human) Length = 836 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 710 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 664
>emb|CR596667.1| full-length cDNA clone CS0DM001YO11 of Fetal liver of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR596389.1| full-length cDNA clone CL0BB011ZE07 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR596329.1| full-length cDNA clone CS0DG007YI12 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR595969.1| full-length cDNA clone CL0BB005ZB09 of Neuroblastoma of Homo sapiens (human) Length = 1289 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1161 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1115
>emb|CR595509.1| full-length cDNA clone CS0DM003YE08 of Fetal liver of Homo sapiens (human) Length = 1264 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR595116.1| full-length cDNA clone CS0DA004YF11 of Neuroblastoma of Homo sapiens (human) Length = 1239 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR595102.1| full-length cDNA clone CS0DI030YI05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1237 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR594097.1| full-length cDNA clone CS0DH004YB09 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 584 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 456 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 410
>emb|CR592120.1| full-length cDNA clone XCL0BA001ZF09 of Placenta of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR590820.1| full-length cDNA clone CL0BA003ZB06 of Placenta of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR590654.1| full-length cDNA clone CS0DA007YC23 of Neuroblastoma of Homo sapiens (human) Length = 1257 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>gb|BC022790.1| Homo sapiens, clone IMAGE:3538792, mRNA, partial cds Length = 1200 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1056 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1010
>ref|XM_936228.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L3 (L4) (LOC653881), mRNA Length = 219 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 149 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 103
>ref|NM_198753.1| Rattus norvegicus ribosomal protein L3 (Rpl3), mRNA Length = 1320 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 207 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 253 ||||||||||| ||||||||||| ||||| | |||||| |||||||| Sbjct: 1171 gtctggaagcgaccatgtccgaatttggaggtggtgtcaatgaactt 1125 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,166,845 Number of Sequences: 3902068 Number of extensions: 3166845 Number of successful extensions: 55674 Number of sequences better than 10.0: 535 Number of HSP's better than 10.0 without gapping: 534 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 54720 Number of HSP's gapped (non-prelim): 947 length of query: 373 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 351 effective length of database: 17,147,199,772 effective search space: 6018667119972 effective search space used: 6018667119972 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
