ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart52e02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY106878.1| Zea mays PCO069584 mRNA sequence 74 3e-10
2gb|BT018853.1| Zea mays clone EL01N0555H12.d mRNA sequence 72 1e-09
3gb|AC163631.5| Mus musculus BAC clone RP23-147B15 from chromosom... 42 1.2
4gb|AC132604.4| Mus musculus BAC clone RP24-80P7 from chromosome ... 42 1.2
5ref|XM_947315.1| Theileria annulata strain Ankara topoisomerase-... 42 1.2
6emb|BX640418.1| Bordetella pertussis strain Tohama I, complete g... 42 1.2
7gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 42 1.2
8gb|AC016580.7|AC016580 Homo sapiens chromosome 5 clone CTD-2509J... 42 1.2
9gb|AC008935.8|AC008935 Homo sapiens chromosome 5 clone CTD-2308L... 42 1.2
10gb|AC008526.5|AC008526 Homo sapiens chromosome 5 clone CTC-470C1... 42 1.2
11gb|AC008873.4|AC008873 Homo sapiens chromosome 5 clone CTD-2199H... 42 1.2
12gb|AF135154.1|AF135154 Bordetella pertussis ferric alcaligin sid... 42 1.2
13gb|AC102525.8| Mus musculus chromosome 8, clone RP24-133K20, com... 40 4.7
14gb|CP000110.1| Synechococcus sp. CC9605, complete genome 40 4.7
15ref|XM_960548.1| Neurospora crassa OR74A hypothetical protein (N... 40 4.7
16gb|AE006108.1| Pasteurella multocida subsp. multocida str. Pm70 ... 40 4.7
17ref|XM_331708.1| Neurospora crassa OR74A hypothetical protein (N... 40 4.7
18ref|XM_654759.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 4.7
19emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 40 4.7
20gb|AF125954.2| Caenorhabditis elegans cosmid C13B7, complete seq... 40 4.7
21emb|AL158196.24| Human DNA sequence from clone RP11-90M2 on chro... 40 4.7
22emb|AL138752.5| Human DNA sequence from clone RP11-3J10 on chrom... 40 4.7
23dbj|AK126527.1| Homo sapiens cDNA FLJ44563 fis, clone UTERU3008917 40 4.7
24gb|AC112214.2| Homo sapiens chromosome 3 clone RP11-649F12, comp... 40 4.7
25gb|AC104167.2| Homo sapiens chromosome 3 clone RP11-253K11, comp... 40 4.7
26emb|CR390077.1| Gallus gallus finished cDNA, clone ChEST997j11 40 4.7
27ref|NM_001029070.1| Caenorhabditis elegans Y45G12C.16 (Y45G12C.1... 40 4.7
28ref|NM_071263.1| Caenorhabditis elegans C13B7.6 (C13B7.6) mRNA, ... 40 4.7
29gb|AC104564.11| Homo sapiens chromosome 17, clone RP11-68I3, com... 40 4.7
30emb|AJ277636.1|PMU277636 Pasteurella multocida mapB gene 40 4.7
31gb|AC006769.1| Caenorhabditis elegans cosmid Y45G12C, complete s... 40 4.7
32gb|AY105845.1| Zea mays PCO069586 mRNA sequence 40 4.7
33gb|AC006226.4|AC006226 Homo sapiens chromosome 4 clone C0011C13 ... 40 4.7

>gb|AY106878.1| Zea mays PCO069584 mRNA sequence
          Length = 718

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 289 gggttctgtccaggctgctgtggaccaggcggcggtggcggcattccatgcct 341
           ||||||||||||||||||||||||||||| ||||| |||||||| ||| ||||
Sbjct: 493 gggttctgtccaggctgctgtggaccaggtggcggaggcggcatcccaggcct 441



to top

>gb|BT018853.1| Zea mays clone EL01N0555H12.d mRNA sequence
          Length = 1287

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 289 gggttctgtccaggctgctgtggaccaggcggcggtggcggcat 332
           ||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 907 gggttctgtccaggctgctgtggaccaggtggcggaggcggcat 864



to top

>gb|AC163631.5| Mus musculus BAC clone RP23-147B15 from chromosome 13, complete
            sequence
          Length = 211368

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 29   taacagagcgaaataacatctcaat 53
            |||||||| ||||||||||||||||
Sbjct: 1315 taacagagagaaataacatctcaat 1291



to top

>gb|AC132604.4| Mus musculus BAC clone RP24-80P7 from chromosome 13, complete sequence
          Length = 164377

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 29     taacagagcgaaataacatctcaat 53
              |||||||| ||||||||||||||||
Sbjct: 100350 taacagagagaaataacatctcaat 100326



to top

>ref|XM_947315.1| Theileria annulata strain Ankara topoisomerase-related
            nucleotidyltransferase (TA12470) partial mRNA
          Length = 1599

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 274  tttttctactactgggggttc 294
            |||||||||||||||||||||
Sbjct: 982  tttttctactactgggggttc 1002



to top

>emb|BX640418.1| Bordetella pertussis strain Tohama I, complete genome; segment 8/12
          Length = 349346

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    tcctcccatcaaaagcaagag 205
              |||||||||||||||||||||
Sbjct: 175916 tcctcccatcaaaagcaagag 175936



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 313     ccaggcggcggtggcggcatt 333
               |||||||||||||||||||||
Sbjct: 1888916 ccaggcggcggtggcggcatt 1888936



to top

>gb|AC016580.7|AC016580 Homo sapiens chromosome 5 clone CTD-2509J24, complete sequence
          Length = 184118

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 209    tacactgacaaggcttttatctctt 233
              ||||| |||||||||||||||||||
Sbjct: 159156 tacacagacaaggcttttatctctt 159180



to top

>gb|AC008935.8|AC008935 Homo sapiens chromosome 5 clone CTD-2308L13, complete sequence
          Length = 102477

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 209   tacactgacaaggcttttatctctt 233
             ||||| |||||||||||||||||||
Sbjct: 32313 tacacagacaaggcttttatctctt 32289



to top

>gb|AC008526.5|AC008526 Homo sapiens chromosome 5 clone CTC-470C15, complete sequence
          Length = 168243

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 269   ataggtttttctactactggg 289
             |||||||||||||||||||||
Sbjct: 39732 ataggtttttctactactggg 39712



to top

>gb|AC008873.4|AC008873 Homo sapiens chromosome 5 clone CTD-2199H11, complete sequence
          Length = 170358

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 209   tacactgacaaggcttttatctctt 233
             ||||| |||||||||||||||||||
Sbjct: 12135 tacacagacaaggcttttatctctt 12159



to top

>gb|AF135154.1|AF135154 Bordetella pertussis ferric alcaligin siderophore receptor (fauA)
            gene, complete cds; and putative multiple antibiotic
            resistance protein (mar) gene, partial cds
          Length = 2898

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  tcctcccatcaaaagcaagag 205
            |||||||||||||||||||||
Sbjct: 1674 tcctcccatcaaaagcaagag 1694



to top

>gb|AC102525.8| Mus musculus chromosome 8, clone RP24-133K20, complete sequence
          Length = 162463

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   caaccaacagttaaacaagc 142
             ||||||||||||||||||||
Sbjct: 42823 caaccaacagttaaacaagc 42804



to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 308    gtggaccaggcggcggtggc 327
              ||||||||||||||||||||
Sbjct: 498053 gtggaccaggcggcggtggc 498072



to top

>ref|XM_960548.1| Neurospora crassa OR74A hypothetical protein (NCU02510.1) partial
            mRNA
          Length = 5037

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 293  tctgtccaggctgctgtgga 312
            ||||||||||||||||||||
Sbjct: 1240 tctgtccaggctgctgtgga 1221



to top

>gb|AE006108.1| Pasteurella multocida subsp. multocida str. Pm70 section 75 of 204 of
            the complete genome
          Length = 10903

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 128  aacagttaaacaagctttag 147
            ||||||||||||||||||||
Sbjct: 6559 aacagttaaacaagctttag 6540



to top

>ref|XM_331708.1| Neurospora crassa OR74A hypothetical protein (NCU02510.1) partial
            mRNA
          Length = 5037

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 293  tctgtccaggctgctgtgga 312
            ||||||||||||||||||||
Sbjct: 1240 tctgtccaggctgctgtgga 1221



to top

>ref|XM_654759.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2247.2), mRNA
          Length = 2163

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 122 acaaccaacagttaaacaag 141
           ||||||||||||||||||||
Sbjct: 182 acaaccaacagttaaacaag 201



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 299     caggctgctgtggaccaggcggcggtgg 326
               ||||| |||| |||||||||||||||||
Sbjct: 2395894 caggccgctgcggaccaggcggcggtgg 2395867



to top

>gb|AF125954.2| Caenorhabditis elegans cosmid C13B7, complete sequence
          Length = 23458

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 316  ggcggcggtggcggcattcc 335
            ||||||||||||||||||||
Sbjct: 7747 ggcggcggtggcggcattcc 7728



to top

>emb|AL158196.24| Human DNA sequence from clone RP11-90M2 on chromosome 13 Contains gene
             FLJ10956, the gene for HSPC126 protein (DRIP36), a novel
             gene similar to polymerase (RNA) II (DNA directed)
             polypeptide K, 7.0kDa (POLR2K), a novel gene and two CpG
             islands, complete sequence
          Length = 152594

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   aggcttttatctcttctcaa 238
             ||||||||||||||||||||
Sbjct: 96128 aggcttttatctcttctcaa 96147



to top

>emb|AL138752.5| Human DNA sequence from clone RP11-3J10 on chromosome 9p12-13.3 Contains
              the 3' end of the SHB gene for SHB (Src homology 2 domain
              containing) adaptor protein B, the MCART1 gene for
              mitochondrial carrier triple repeat 1 (MGC14836), a novel
              gene, a novel pseudogene, a phosphoribosylaminoimidazole
              carboxylase, phosphoribosylaminoimidazole
              succinocarboxamide synthetase (PAICS) pseudogene, a novel
              gene (MGC10765,FLJ23201), a mitochondrial ribosomal protein
              S10 (MRP-S10, FLJ10567, PNAS-122) (MRPS10) psueodgene, the
              gene for exosome component RRP40, a novel gene (FLJ31455)
              and four CpG islands, complete sequence
          Length = 189271

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 283    tactgggggttctgtccagg 302
              ||||||||||||||||||||
Sbjct: 152824 tactgggggttctgtccagg 152805



to top

>dbj|AK126527.1| Homo sapiens cDNA FLJ44563 fis, clone UTERU3008917
          Length = 3622

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 283 tactgggggttctgtccagg 302
           ||||||||||||||||||||
Sbjct: 296 tactgggggttctgtccagg 277



to top

>gb|AC112214.2| Homo sapiens chromosome 3 clone RP11-649F12, complete sequence
          Length = 173990

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 266   cagataggtttttctactac 285
             ||||||||||||||||||||
Sbjct: 93588 cagataggtttttctactac 93607



to top

>gb|AC104167.2| Homo sapiens chromosome 3 clone RP11-253K11, complete sequence
          Length = 173288

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 266   cagataggtttttctactac 285
             ||||||||||||||||||||
Sbjct: 45674 cagataggtttttctactac 45693



to top

>emb|CR390077.1| Gallus gallus finished cDNA, clone ChEST997j11
          Length = 608

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 175 acagtccgtctcctcccatc 194
           ||||||||||||||||||||
Sbjct: 289 acagtccgtctcctcccatc 270



to top

>ref|NM_001029070.1| Caenorhabditis elegans Y45G12C.16 (Y45G12C.16) mRNA, complete cds
          Length = 591

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ggcggcggtggcggcattcc 335
           ||||||||||||||||||||
Sbjct: 206 ggcggcggtggcggcattcc 187



to top

>ref|NM_071263.1| Caenorhabditis elegans C13B7.6 (C13B7.6) mRNA, complete cds
          Length = 582

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ggcggcggtggcggcattcc 335
           ||||||||||||||||||||
Sbjct: 206 ggcggcggtggcggcattcc 187



to top

>gb|AC104564.11| Homo sapiens chromosome 17, clone RP11-68I3, complete sequence
          Length = 173058

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 29    taacagagcgaaataacatctcaa 52
             ||||||||||||| ||||||||||
Sbjct: 73807 taacagagcgaaacaacatctcaa 73830



to top

>emb|AJ277636.1|PMU277636 Pasteurella multocida mapB gene
          Length = 8139

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 128  aacagttaaacaagctttag 147
            ||||||||||||||||||||
Sbjct: 4110 aacagttaaacaagctttag 4129



to top

>gb|AC006769.1| Caenorhabditis elegans cosmid Y45G12C, complete sequence
          Length = 51235

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 316  ggcggcggtggcggcattcc 335
            ||||||||||||||||||||
Sbjct: 8043 ggcggcggtggcggcattcc 8024



to top

>gb|AY105845.1| Zea mays PCO069586 mRNA sequence
          Length = 767

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 289 gggttctgtccaggctgctgtggaccaggcggcggtggcggcat 332
           ||||| |||||||||||||| || ||||| ||||| || |||||
Sbjct: 343 gggttttgtccaggctgctgcgggccaggtggcggaggtggcat 300



to top

>gb|AC006226.4|AC006226 Homo sapiens chromosome 4 clone C0011C13 map 4p16, complete sequence
          Length = 162349

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     aaagcaatttatgatctgaa 26
             ||||||||||||||||||||
Sbjct: 81082 aaagcaatttatgatctgaa 81063


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,472,213
Number of Sequences: 3902068
Number of extensions: 3472213
Number of successful extensions: 75760
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75675
Number of HSP's gapped (non-prelim): 85
length of query: 352
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 330
effective length of database: 17,147,199,772
effective search space: 5658575924760
effective search space used: 5658575924760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top