ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart52b03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein,... 547 e-153
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 280 3e-72
3dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic D... 280 3e-72
4dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clon... 280 3e-72
5dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 280 3e-72
6dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clon... 272 8e-70
7emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4 224 2e-55
8gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps... 212 6e-52
9gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds 204 2e-49
10gb|BT016261.1| Zea mays clone Contig94 mRNA sequence 198 1e-47
11gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA,... 198 1e-47
12gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence 188 9e-45
13ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predic... 157 3e-35
14dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 157 3e-35
15dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic D... 157 3e-35
16dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 3e-35
17gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4... 143 5e-31
18ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predic... 133 5e-28
19gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome... 133 5e-28
20dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 133 5e-28
21dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 5e-28
22gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete s... 123 5e-25
23dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, com... 86 1e-13
24emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal pro... 82 2e-12
25gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, comple... 78 2e-11
26gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal prot... 74 4e-10
27gb|AY110862.1| Zea mays CL1882_8 mRNA sequence 68 2e-08
28emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
29ref|NM_125228.3| Arabidopsis thaliana structural constituent of ... 58 2e-05
30gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, comp... 58 2e-05
31gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, comp... 58 2e-05
32gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mR... 58 2e-05
33emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
34emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
35emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
36emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
37emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
38emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
39gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete s... 58 2e-05
40dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 58 2e-05
41ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothe... 56 9e-05
42ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hyp... 56 9e-05
43gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-lik... 56 9e-05
44ref|NM_001036769.1| Arabidopsis thaliana structural constituent ... 54 4e-04
45ref|NM_120791.2| Arabidopsis thaliana structural constituent of ... 54 4e-04
46gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence 54 4e-04
47gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA 54 4e-04
48gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal prote... 54 4e-04
49gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal prote... 54 4e-04
50emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, B... 54 4e-04
51ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG... 54 4e-04
52gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co... 54 4e-04
53ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG... 54 4e-04
54gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell ... 54 4e-04
55gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co... 54 4e-04
56emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
57emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
58emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
59emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
60gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete s... 54 4e-04
61dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 4e-04
62emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal prote... 54 4e-04
63gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46... 54 4e-04
64dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribos... 54 4e-04
65ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predi... 50 0.005
66gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 ... 50 0.005
67emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 50 0.005
68ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.022
69gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putat... 48 0.022
70ref|XM_775416.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.086
71emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Co... 46 0.086
72emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Co... 46 0.086
73emb|BX067601.1|CNS09OBP Single read from an extremity of a full-... 44 0.34
74emb|BX067600.1|CNS09OBO Single read from an extremity of a full-... 44 0.34
75gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gen... 44 0.34
76dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.34
77gb|AY439895.1| Armigeres subalbatus ASAP ID: 38941 cytosolic sma... 42 1.3
78gb|AY433736.1| Aedes aegypti ASAP ID: 34407 cytosolic small ribo... 42 1.3
79gb|DQ440018.1| Aedes aegypti clone AE-221 40S ribosomal protein ... 42 1.3
80gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosom... 42 1.3
81ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.3
82emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 42 1.3
83ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small rib... 42 1.3
84emb|CR938551.1| Single read from an extremity of a full-length c... 42 1.3
85emb|CR938407.1| Single read from an extremity of a full-length c... 42 1.3
86emb|CR938406.1| Single read from an extremity of a full-length c... 42 1.3
87emb|CR938380.1| Single read from an extremity of a full-length c... 42 1.3
88emb|CR938366.1| Single read from an extremity of a full-length c... 42 1.3
89gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete s... 42 1.3
90gb|AE012037.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 1.3
91dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 42 1.3
92gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA ... 40 5.3
93ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1... 40 5.3
94gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 5.3
95gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, com... 40 5.3
96gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence 40 5.3
97gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, com... 40 5.3
98gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 40 5.3
99ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 5.3
100gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome... 40 5.3
101ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (... 40 5.3
102gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRN... 40 5.3
103emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227... 40 5.3
104emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chrom... 40 5.3
105ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predi... 40 5.3
106ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 5.3
107emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clo... 40 5.3
108emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 i... 40 5.3
109gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, com... 40 5.3
110gb|AC007437.16| Homo sapiens 12q22 BAC RPCI11-541G9 (Roswell Par... 40 5.3
111gb|AC007656.2| Homo sapiens 12q22 BAC RPCI11-534P6 (Rowswell Par... 40 5.3
112gb|AC150660.4| Mus musculus BAC clone RP23-41F9 from chromosome ... 40 5.3
113gb|AC133282.7| Mus musculus chromosome 15, clone RP24-408B1, com... 40 5.3
114dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21,... 40 5.3
115gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, com... 40 5.3
116emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1... 40 5.3
117gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein ... 40 5.3
118gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosom... 40 5.3
119dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 5.3
120gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, co... 40 5.3
121gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, comple... 40 5.3
122gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, com... 40 5.3
123emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 5.3
124emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chr... 40 5.3
125emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-6... 40 5.3
126dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL... 40 5.3
127dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, co... 40 5.3
128dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 5.3
129dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related... 40 5.3 
>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds
          Length = 1053

 Score =  547 bits (276), Expect = e-153
 Identities = 346/368 (94%), Gaps = 1/368 (0%)
 Strand = Plus / Minus

                                                                        
Query: 28   taaacatccacattacatctagcagcatccatgggttcgcaaatcaacaaacatcaggca 87
            ||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||
Sbjct: 1036 taaacatccacattacatctagcagcaaccatgggttcacaattcaacaaacatcaggca 977

                                                                        
Query: 88   aaacttaaaaaagatggttccaggaacatagttctatatccttgcagataactggctata 147
            ||| ||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||
Sbjct: 976  aaatttaaaaacgatggttccagaaacatagttctatatcctt-cagataactggctata 918

                                                                        
Query: 148  gcaaaacgactcaatgcctcagaatcaggccttggcagcagcctgagctgcggcatccct 207
            ||||||||| |||| |||||||||||||||||||||||| ||||| || |||||||||||
Sbjct: 917  gcaaaacgaatcaacgcctcagaatcaggccttggcagctgcctgggcagcggcatccct 858

                                                                        
Query: 208  cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
            |||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||
Sbjct: 857  cttcctctgctcctcaatgatggtcagcttgatacctttgcccttggggagggtcaccca 798

                                                                        
Query: 268  aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 327
             ||||||||||||||||| ||||||||||| ||||| ||||||||||| |||||||||||
Sbjct: 797  cggcttggtgcccttgccgatggtgaacacattgcctagacgggtggcgaactggtgacc 738

                                                                        
Query: 328  ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
            ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 737  ctgagcatcctcaacgtggatggtctcgaaggttcccttatgcttctccctgttcttgat 678

                    
Query: 388  cacaccaa 395
            ||||||||
Sbjct: 677  cacaccaa 670
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score =  280 bits (141), Expect = 3e-72
 Identities = 198/217 (91%)
 Strand = Plus / Plus

                                                                          
Query: 179    ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
              |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026

                                                                          
Query: 239    atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
              || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 317086

                                                                          
Query: 299    ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 358
              ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 317087 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 317146

                                                   
Query: 359    gttcccttatgcttctccctgttcttgatcacaccaa 395
               | || |||||||||||||||||||||||||||||||
Sbjct: 317147 ctgcctttatgcttctccctgttcttgatcacaccaa 317183



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                      
Query: 115    atagttctatatccttgcagataactggctatagcaaaac 154
              ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 316896 atagttctatatccttgcaaacaactcgctatagcaaaac 316935
to top
>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1359_D06
          Length = 146805

 Score =  280 bits (141), Expect = 3e-72
 Identities = 198/217 (91%)
 Strand = Plus / Plus

                                                                         
Query: 179   ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
             |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810

                                                                         
Query: 239   atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
             || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 45870

                                                                         
Query: 299   ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 358
             ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 45871 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 45930

                                                  
Query: 359   gttcccttatgcttctccctgttcttgatcacaccaa 395
              | || |||||||||||||||||||||||||||||||
Sbjct: 45931 ctgcctttatgcttctccctgttcttgatcacaccaa 45967



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 115   atagttctatatccttgcagataactggctatagcaaaac 154
             ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 45680 atagttctatatccttgcaaacaactcgctatagcaaaac 45719
to top
>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full
           insert sequence
          Length = 1016

 Score =  280 bits (141), Expect = 3e-72
 Identities = 198/217 (91%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 767

                                                                       
Query: 299 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 358
           ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 766 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 707

                                                
Query: 359 gttcccttatgcttctccctgttcttgatcacaccaa 395
            | || |||||||||||||||||||||||||||||||
Sbjct: 706 ctgcctttatgcttctccctgttcttgatcacaccaa 670



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 115 atagttctatatccttgcagataactggctatagcaaaac 154
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 957 atagttctatatccttgcaaacaactcgctatagcaaaac 918
to top
>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full
           insert sequence
          Length = 1157

 Score =  280 bits (141), Expect = 3e-72
 Identities = 198/217 (91%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 771

                                                                       
Query: 299 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 358
           ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 770 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 711

                                                
Query: 359 gttcccttatgcttctccctgttcttgatcacaccaa 395
            | || |||||||||||||||||||||||||||||||
Sbjct: 710 ctgcctttatgcttctccctgttcttgatcacaccaa 674



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 115 atagttctatatccttgcagataactggctatagcaaaac 154
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 961 atagttctatatccttgcaaacaactcgctatagcaaaac 922
to top
>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full
           insert sequence
          Length = 1079

 Score =  272 bits (137), Expect = 8e-70
 Identities = 197/217 (90%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||  
Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaaa 763

                                                                       
Query: 299 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 358
           ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 762 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 703

                                                
Query: 359 gttcccttatgcttctccctgttcttgatcacaccaa 395
            | || |||||||||||||||||||||||||||||||
Sbjct: 702 ctgcctttatgcttctccctgttcttgatcacaccaa 666



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 115 atagttctatatccttgcagataactggctatagcaaaac 154
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 953 atagttctatatccttgcaaacaactcgctatagcaaaac 914
to top
>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4
          Length = 1148

 Score =  224 bits (113), Expect = 2e-55
 Identities = 194/217 (89%), Gaps = 3/217 (1%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcct-caatgatggtgagctt 237
           |||||||||||||| || || || |||| |||||| ||||||| | |||||| |||||||
Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807

                                                                       
Query: 238 gatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacac 297
           ||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||
Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacac 747

                                                                       
Query: 298 gttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaa 357
            ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| ||
Sbjct: 746 attgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaa 687

                                                
Query: 358 ggttcccttatgcttctccctgttcttgatcacacca 394
            | | |||| |||||||||||||| ||||||||||||
Sbjct: 686 -gctgccttttgcttctccctgttgttgatcacacca 651



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 115 atagttctatatcc-ttgcagataactggctatagcaaaac 154
           |||||||||||||| ||||| | |||| |||||||||||||
Sbjct: 937 atagttctatatcctttgcaaacaactcgctatagcaaaac 897
to top
>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds
          Length = 1013

 Score =  212 bits (107), Expect = 6e-52
 Identities = 188/215 (87%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 804 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 745

                                                                       
Query: 299 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 358
           ||||||| ||||||||| |||||||| ||| |||  ||||| ||||| ||||||||||||
Sbjct: 744 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaaag 685

                                              
Query: 359 gttcccttatgcttctccctgttcttgatcacacc 393
            | ||||| |||||||||||||||||||| |||||
Sbjct: 684 ctgcccttgtgcttctccctgttcttgataacacc 650



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 111 gaacatagttctatatccttgcaga 135
           |||||| ||||||||||||||||||
Sbjct: 936 gaacattgttctatatccttgcaga 912
to top
>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds
          Length = 1037

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 802 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 743

                                                                       
Query: 299 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 358
           ||||||| ||||||||| |||||||| ||| |||  ||||| ||||| |||||||||| |
Sbjct: 742 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaagg 683

                                              
Query: 359 gttcccttatgcttctccctgttcttgatcacacc 393
            | ||||| |||||||||||||||||||| |||||
Sbjct: 682 ctgcccttgtgcttctccctgttcttgataacacc 648



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 111 gaacatagttctatatccttgcaga 135
           |||||| ||||||||||||||||||
Sbjct: 934 gaacattgttctatatccttgcaga 910
to top
>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence
          Length = 1116

 Score =  198 bits (100), Expect = 1e-47
 Identities = 163/184 (88%)
 Strand = Plus / Minus

                                                                       
Query: 210 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 269
           ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| |
Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806

                                                                       
Query: 270 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccct 329
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||||| ||| 
Sbjct: 805 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 746

                                                                       
Query: 330 gggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 389
            ||  ||||| ||||||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 745 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 686

               
Query: 390 cacc 393
           ||||
Sbjct: 685 cacc 682
to top
>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds
          Length = 1090

 Score =  198 bits (100), Expect = 1e-47
 Identities = 163/184 (88%)
 Strand = Plus / Minus

                                                                       
Query: 210 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 269
           ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| |
Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785

                                                                       
Query: 270 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccct 329
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||||| ||| 
Sbjct: 784 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 725

                                                                       
Query: 330 gggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 389
            ||  ||||| ||||||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 724 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 665

               
Query: 390 cacc 393
           ||||
Sbjct: 664 cacc 661
to top
>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence
          Length = 1145

 Score =  188 bits (95), Expect = 9e-45
 Identities = 185/215 (86%)
 Strand = Plus / Plus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || || ||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || ||||| |||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 238 attcccttacccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 297

                                                                       
Query: 299 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 358
           ||||||| ||||||||| |||||||| ||| |||  ||||| ||||| || |||||||||
Sbjct: 298 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatagtctcaaag 357

                                              
Query: 359 gttcccttatgcttctccctgttcttgatcacacc 393
            | ||||| |||||||||||||||||||| |||||
Sbjct: 358 ctgcccttgtgcttctccctgttcttgataacacc 392



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 110 ggaacatagttctatatccttgcaga 135
           ||||||| ||||||||||||||||||
Sbjct: 105 ggaacattgttctatatccttgcaga 130
to top
>ref|NM_193994.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 768

 Score =  157 bits (79), Expect = 3e-35
 Identities = 172/203 (84%)
 Strand = Plus / Minus

                                                                       
Query: 182 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 241
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699

                                                                       
Query: 242 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
           ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 639

                                                                       
Query: 302 cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 361
           |||||||||||||| ||    || |||   || ||||| || ||||||||||||||  | 
Sbjct: 638 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 579

                                  
Query: 362 cccttatgcttctccctgttctt 384
           ||||| |||||||||||||||||
Sbjct: 578 cccttgtgcttctccctgttctt 556
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  157 bits (79), Expect = 3e-35
 Identities = 172/203 (84%)
 Strand = Plus / Minus

                                                                            
Query: 182      gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 241
                |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910

                                                                            
Query: 242      cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
                ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 14497850

                                                                            
Query: 302      cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 361
                |||||||||||||| ||    || |||   || ||||| || ||||||||||||||  | 
Sbjct: 14497849 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 14497790

                                       
Query: 362      cccttatgcttctccctgttctt 384
                ||||| |||||||||||||||||
Sbjct: 14497789 cccttgtgcttctccctgttctt 14497767
to top
>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0514H03
          Length = 167230

 Score =  157 bits (79), Expect = 3e-35
 Identities = 172/203 (84%)
 Strand = Plus / Minus

                                                                         
Query: 182   gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 241
             |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223

                                                                         
Query: 242   cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
             ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 57163

                                                                         
Query: 302   cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 361
             |||||||||||||| ||    || |||   || ||||| || ||||||||||||||  | 
Sbjct: 57162 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 57103

                                    
Query: 362   cccttatgcttctccctgttctt 384
             ||||| |||||||||||||||||
Sbjct: 57102 cccttgtgcttctccctgttctt 57080
to top
>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full
           insert sequence
          Length = 1035

 Score =  157 bits (79), Expect = 3e-35
 Identities = 172/203 (84%)
 Strand = Plus / Minus

                                                                       
Query: 182 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 241
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816

                                                                       
Query: 242 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
           ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 756

                                                                       
Query: 302 cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 361
           |||||||||||||| ||    || |||   || ||||| || ||||||||||||||  | 
Sbjct: 755 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 696

                                  
Query: 362 cccttatgcttctccctgttctt 384
           ||||| |||||||||||||||||
Sbjct: 695 cccttgtgcttctccctgttctt 673
to top
>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds
          Length = 1086

 Score =  143 bits (72), Expect = 5e-31
 Identities = 141/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 tcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggtgccc 280
           |||| |||||| ||||||||||| || |||||||| ||   ||||||||| || || |||
Sbjct: 783 tcaaggatggttagcttgatacctttccccttgggaagagacacccaaggttttgtaccc 724

                                                                       
Query: 281 ttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccctgggcatcctca 340
           ||||||||||||||||| || || || || || ||||||| ||||||   |||||||| |
Sbjct: 723 ttgccaatggtgaacacattaccaagccgagtagcaaactcgtgaccagtggcatcctga 664

                                                       
Query: 341 acgtggatggtctcaaaggttcccttatgcttctccctgttctt 384
           |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 663 acgtggatggtctcaaagcttcccttatgcttctccctgttctt 620
to top
>ref|XM_475130.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 738

 Score =  133 bits (67), Expect = 5e-28
 Identities = 154/183 (84%)
 Strand = Plus / Minus

                                                                       
Query: 208 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
           |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 708 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 649

                                                                       
Query: 268 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 327
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 648 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 589

                                                                       
Query: 328 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
             |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 588 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 529

              
Query: 388 cac 390
           |||
Sbjct: 528 cac 526
to top
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07,
             complete sequence
          Length = 159932

 Score =  133 bits (67), Expect = 5e-28
 Identities = 154/183 (84%)
 Strand = Plus / Minus

                                                                         
Query: 208   cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
             |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 81033 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 80974

                                                                         
Query: 268   aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 327
              |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 80973 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 80914

                                                                         
Query: 328   ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
               |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 80913 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 80854

                
Query: 388   cac 390
             |||
Sbjct: 80853 cac 80851
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  133 bits (67), Expect = 5e-28
 Identities = 154/183 (84%)
 Strand = Plus / Minus

                                                                            
Query: 208      cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
                |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 17551228 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 17551169

                                                                            
Query: 268      aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 327
                 |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 17551168 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 17551109

                                                                            
Query: 328      ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
                  |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 17551108 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 17551049

                   
Query: 388      cac 390
                |||
Sbjct: 17551048 cac 17551046
to top
>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full
           insert sequence
          Length = 1162

 Score =  133 bits (67), Expect = 5e-28
 Identities = 154/183 (84%)
 Strand = Plus / Minus

                                                                       
Query: 208 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
           |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 860 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 801

                                                                       
Query: 268 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 327
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 800 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 741

                                                                       
Query: 328 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
             |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 740 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 681

              
Query: 388 cac 390
           |||
Sbjct: 680 cac 678
to top
>gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete sequence
          Length = 128856

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                         
Query: 190   ctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgatacccttgcc 249
             ||||||||| ||| ||||||||||    ||||||||||  || |  || |||||||| ||
Sbjct: 83725 ctgagctgcagcagccctcttcctagcttcctcaatgacagttaatttaatacccttacc 83666

                                                                         
Query: 250   cttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttgcccagacg 309
             |||||| ||    ||||| ||||| || ||||||||||| |||||||| ||| |||||||
Sbjct: 83665 cttgggaagagatacccatggctttgtccccttgccaatagtgaacacattgaccagacg 83606

                                                                         
Query: 310   ggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggttcccttatg 369
              || |||||||  |||||   |||||||| ||||||||| ||||||||||||||||||||
Sbjct: 83605 agttgcaaactcatgaccagtggcatcctgaacgtggattgtctcaaaggttcccttatg 83546

                                       
Query: 370   cttctccctgttcttgatcacaccaa 395
             ||| || |||||||||||||| ||||
Sbjct: 83545 cttttctctgttcttgatcactccaa 83520
to top
>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds
          Length = 1105

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 139/171 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           ||||||||||||||| |  |||||||||||||||||||| ||   |||||| ||||| ||
Sbjct: 840 ctcctcaatgatggttaatttgatacccttgcccttgggaagagacacccatggctttgt 781

                                                                       
Query: 277 gcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccctgggcatc 336
            || || || ||||| || || ||||| ||||| || ||||||| ||||||  ||| |||
Sbjct: 780 accttttccgatggtaaaaacattgcctagacgagtagcaaactcgtgaccaagggaatc 721

                                                              
Query: 337 ctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
           || || ||| |  ||||| ||| | |||||||| |||||||||||||||||
Sbjct: 720 ctgaatgtgaacagtctcgaagctccccttatgtttctccctgttcttgat 670
to top
>emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal protein S4
          Length = 966

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 110/133 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactgg 322
           ||||| ||||| || ||||| ||||  |||||||| || |||| ||| || ||||| |  
Sbjct: 756 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 697

                                                                       
Query: 323 tgaccctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttc 382
           |||||||| | ||||| || ||||| |||||||||| | |||||||||||||||||||||
Sbjct: 696 tgaccctgtgaatcctgaatgtggagggtctcaaagctacccttatgcttctccctgttc 637

                        
Query: 383 ttgatcacaccaa 395
           || || |||||||
Sbjct: 636 ttaataacaccaa 624
to top
>gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, complete cds
          Length = 1054

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccc 328
           ||||| |||||||||||||| |||||||| |||||||  || || ||||| |  || || 
Sbjct: 798 ggctttgtgcccttgccaatagtgaacacattgcccatgcgagtagcaaattcatgtcca 739

                                                                       
Query: 329 tgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatc 388
             || |||||  ||||| || ||||||||| | |||||||||||||||||||||||||||
Sbjct: 738 gtggaatcctgcacgtgaattgtctcaaagctacccttatgcttctccctgttcttgatc 679

                  
Query: 389 acaccaa 395
           || ||||
Sbjct: 678 actccaa 672
to top
>gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal protein S4-like
           protein mRNA, complete cds
          Length = 1052

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 109/133 (81%)
 Strand = Plus / Minus

                                                                       
Query: 263 acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactgg 322
           ||||| ||||| || ||||| ||||  |||||||| || |||| ||| || ||||| |  
Sbjct: 739 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 680

                                                                       
Query: 323 tgaccctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttc 382
           |||||||| | ||| | || ||||| |||||||||| | |||||||||||||||||||||
Sbjct: 679 tgaccctgtgaatcttgaatgtggagggtctcaaagctacccttatgcttctccctgttc 620

                        
Query: 383 ttgatcacaccaa 395
           || || |||||||
Sbjct: 619 ttaataacaccaa 607
to top
>gb|AY110862.1| Zea mays CL1882_8 mRNA sequence
          Length = 728

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 341 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcac 390
           |||||||||||||| ||| | ||||| |||||||||||||||||||||||
Sbjct: 491 acgtggatggtctcgaagctgcccttgtgcttctccctgttcttgatcac 442



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 370 cttctccctgttcttgatcac 390
           |||||||||||||||||||||
Sbjct: 429 cttctccctgttcttgatcac 409
to top
>emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZB04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||||||||||||||||| || | |||||| ||||||||
Sbjct: 625 gtggattgtctcaaaggttcccttatgcttttcacggttcttaatcacacc 575
to top
>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420
           mRNA, complete cds
          Length = 1080

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 846 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 787

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 786 tcctttgccaatggtgtacac 766



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 720 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 668
to top
>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds
          Length = 789

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 753 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 694

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 693 tcctttgccaatggtgtacac 673



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 575
to top
>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 995

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 766 tcctttgccaatggtgtacac 746



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 648
to top
>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 1005

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 837 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 778

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 777 tcctttgccaatggtgtacac 757



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 711 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 659
to top
>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 978

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 847 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 788

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 787 tcctttgccaatggtgtacac 767



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 721 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 669
to top
>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 537

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 366 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 307

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 306 tcctttgccaatggtgtacac 286



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 240 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 188
to top
>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 988

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 817 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 758

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 757 tcctttgccaatggtgtacac 737



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 691 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 639
to top
>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 737

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 566 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 507

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 506 tcctttgccaatggtgtacac 486



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 440 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 388
to top
>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB12ZD07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 566

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 395 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 336

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 335 tcctttgccaatggtgtacac 315



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 269 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 217
to top
>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 997

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 766 tcctttgccaatggtgtacac 746



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 648
to top
>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence
          Length = 1010

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 841 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 782

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 781 tcctttgccaatggtgtacac 761



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
           |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 715 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 663
to top
>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2
          Length = 51440

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 217  ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
            |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 6898 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 6839

                                 
Query: 277  gcccttgccaatggtgaacac 297
             || |||||||||||| ||||
Sbjct: 6838 tcctttgccaatggtgtacac 6818



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 343  gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaa 395
            |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||
Sbjct: 6772 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaa 6720
to top
>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
           (MG02747.4) partial mRNA
          Length = 735

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 216 gctcctcaatgatggtgagcttgatacccttgcccttggg 255
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658
to top
>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein
           (FG08714.1) partial mRNA
          Length = 732

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 216 gctcctcaatgatggtgagcttgatacccttgcccttggg 255
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658
to top
>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA,
           complete cds
          Length = 1024

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 216 gctcctcaatgatggtgagcttgatacccttgcccttggg 255
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727
to top
>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.2 mRNA, complete cds
          Length = 1174

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 739 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 689



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 864 tcctcaatgatggtcagcttaatacctttgccctt 830
to top
>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.1 mRNA, complete cds
          Length = 1088

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 604



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
to top
>gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence
          Length = 1292

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                       
Query: 290 gtgaacacgttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatg 349
           |||||||| || |||| |||||| |||||||  || ||| ||| ||||| || ||| |  
Sbjct: 760 gtgaacacatttcccaaacgggtagcaaactcatgccccagggaatcctgaatgtgaact 701

                                              
Query: 350 gtctcaaaggttcccttatgcttctccctgttctt 384
           ||||||||| | ||||| |||||||||||||||||
Sbjct: 700 gtctcaaagctacccttgtgcttctccctgttctt 666
to top
>gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA
          Length = 992

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767
to top
>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 820

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 577



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
to top
>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 1059

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 601



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
to top
>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA
            project)
          Length = 104607

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 343  gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
            |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 7896 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 7846



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 218  tcctcaatgatggtgagcttgatacccttgccctt 252
            |||||||||||||| ||||| ||||| ||||||||
Sbjct: 8021 tcctcaatgatggtcagcttaatacctttgccctt 7987
to top
>ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG11276-RA, transcript
           variant A (RpS4), mRNA
          Length = 983

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767
to top
>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 789

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 577



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
to top
>ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG11276-RB, transcript
           variant B (RpS4), mRNA
          Length = 969

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 799 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 753
to top
>gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 207761

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 269    ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
              |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 141932 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 141886
to top
>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 1008

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 601



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
to top
>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1168

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 354 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 404



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 229 tcctcaatgatggtcagcttaatacctttgccctt 263
to top
>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 976

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 621 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 571



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 746 tcctcaatgatggtcagcttaatacctttgccctt 712
to top
>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 942

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 625 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 575



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 750 tcctcaatgatggtcagcttaatacctttgccctt 716
to top
>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 952

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 614 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 564



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 739 tcctcaatgatggtcagcttaatacctttgccctt 705
to top
>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence
          Length = 1011

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 604



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
to top
>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9
          Length = 86380

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                
Query: 343   gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
             |||||| ||||||||| ||||||||||||| || | |||||| ||||||||
Sbjct: 82619 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacc 82569



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 218   tcctcaatgatggtgagcttgatacccttgccctt 252
             |||||||||||||| ||||| ||||| ||||||||
Sbjct: 82744 tcctcaatgatggtcagcttaatacctttgccctt 82710
to top
>emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal protein small subunit 4e
          Length = 1090

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 347 atggtctcaaaggttcccttatgcttctccctgtt 381
           |||||||||||| | ||||||||||||||||||||
Sbjct: 678 atggtctcaaagctacccttatgcttctccctgtt 644
to top
>gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46 of 83 of the complete
              sequence
          Length = 272016

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 269    ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
              |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 169866 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 169820
to top
>dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribosomal protein S4,
           complete cds
          Length = 870

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 713 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 667
to top
>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA
          Length = 783

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 227 atggtgagcttgatacccttgcccttggg 255
           |||| ||||||||||||||||||||||||
Sbjct: 743 atggagagcttgatacccttgcccttggg 715
to top
>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds
          Length = 852

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 227 atggtgagcttgatacccttgcccttggg 255
           |||| ||||||||||||||||||||||||
Sbjct: 745 atggagagcttgatacccttgcccttggg 717
to top
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 227     atggtgagcttgatacccttgcccttggg 255
               |||| ||||||||||||||||||||||||
Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919
to top
>ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus similar to CG11276-PA,
           isoform A (LOC583495), partial mRNA
          Length = 285

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 293 aacacgttgcccagacgggtggca 316
           ||||||||||||||||||||||||
Sbjct: 179 aacacgttgcccagacgggtggca 156
to top
>gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putative ribosomal
           protein S4e mRNA, complete cds
          Length = 792

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 269 ggcttggtgcccttgccaatggtgaacacgtt 300
           ||||||||||||||||||||| |||| |||||
Sbjct: 701 ggcttggtgcccttgccaatgatgaagacgtt 670
to top
>ref|XM_775416.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S4, X isoform (LOC574997), mRNA
          Length = 825

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
           ||||||||||||||||||   ||  | | |||| || ||||||| |||  ||||||||||
Sbjct: 770 cccttgcccttggggagggagacgtaggccttgttggccttgccgatgacgaacacgttg 711

                          
Query: 302 cccagacgggtggca 316
           || ||||||||||||
Sbjct: 710 ccaagacgggtggca 696
to top
>emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL68ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 984

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||| | ||||||||||||| || | |||||| ||||||||
Sbjct: 625 gtggattgtctcaaggcttcccttatgcttttcacggttcttaatcacacc 575
to top
>emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 343 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacacc 393
           |||||| ||||||| | |||||||||||||||| | |||||  ||||||||
Sbjct: 625 gtggattgtctcaacgcttcccttatgcttctcacggttctgaatcacacc 575
to top
>emb|BX067601.1|CNS09OBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 271 cttggtgcccttgccaatggtgaacacgtt 300
           |||||||| |||||| ||||||||||||||
Sbjct: 282 cttggtgctcttgccgatggtgaacacgtt 311
to top
>emb|BX067600.1|CNS09OBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 271 cttggtgcccttgccaatggtgaacacgtt 300
           |||||||| |||||| ||||||||||||||
Sbjct: 712 cttggtgctcttgccgatggtgaacacgtt 683
to top
>gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gene, partial cds
          Length = 416

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 61  ggttcgcaaatcaacaaacatcaggc 86
           |||||||||||| |||||||||||||
Sbjct: 88  ggttcgcaaatcgacaaacatcaggc 113
to top
>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14
          Length = 86121

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 47/54 (87%), Gaps = 1/54 (1%)
 Strand = Plus / Plus

                                                                   
Query: 343   gtggatggtctcaaaggttcccttatg-cttctccctgttcttgatcacaccaa 395
             |||||||||||||||| ||||||| ||  || || | |||||||||||||||||
Sbjct: 15623 gtggatggtctcaaagcttcccttttgttttttcacggttcttgatcacaccaa 15676
to top
>gb|AY439895.1| Armigeres subalbatus ASAP ID: 38941 cytosolic small ribosomal
           subunit S4 mRNA sequence
          Length = 960

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| ||||||| ||| ||||||||||   ||||||||||||
Sbjct: 729 cttggtggccttgccgatgatgaacacgttagtcagacgggtggc 685
to top
>gb|AY433736.1| Aedes aegypti ASAP ID: 34407 cytosolic small ribosomal subunit S4
           mRNA sequence
          Length = 755

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 444 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 400
to top
>gb|DQ440018.1| Aedes aegypti clone AE-221 40S ribosomal protein S4 mRNA, complete
           cds
          Length = 789

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 699 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 655
to top
>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete sequence
          Length = 149455

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 249    ccttggggaggctcacccaag 269
              |||||||||||||||||||||
Sbjct: 134897 ccttggggaggctcacccaag 134877
to top
>ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4794.2), mRNA
          Length = 720

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 227 atggtgagcttgatacccttgcccttggg 255
           |||| |||||||| |||||||||||||||
Sbjct: 674 atggagagcttgacacccttgcccttggg 646
to top
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 321     ggtgaccctgggcatcctcaacgtg 345
               ||||||||||||||| |||||||||
Sbjct: 4589196 ggtgaccctgggcatgctcaacgtg 4589172
to top
>ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small ribosomal subunit S4
           (Afu3g06840) partial mRNA
          Length = 786

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 227 atggtgagcttgatacccttgcccttggg 255
           ||||||||||| | |||||||||||||||
Sbjct: 740 atggtgagcttaacacccttgcccttggg 712
to top
>emb|CR938551.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YI07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 747

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 721 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 677
to top
>emb|CR938407.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YA05AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 806

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 720 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 676
to top
>emb|CR938406.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YA05BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 605

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 296 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 340
to top
>emb|CR938380.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB03AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 808

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 722 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 678
to top
>emb|CR938366.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB15AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 810

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 723 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 679
to top
>gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete sequence
          Length = 124792

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 371    ttctccctgttcttgatcaca 391
              |||||||||||||||||||||
Sbjct: 120862 ttctccctgttcttgatcaca 120842
to top
>gb|AE012037.1| Xanthomonas axonopodis pv. citri str. 306,  section 415 of 469 of the
            complete genome
          Length = 10848

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 321  ggtgaccctgggcatcctcaacgtg 345
            ||||||||||||||| |||||||||
Sbjct: 8128 ggtgaccctgggcatgctcaacgtg 8104
to top
>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020
          Length = 1824958

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 235    cttgatacccttgcccttggggagg 259
              ||||| |||||||||||||||||||
Sbjct: 775952 cttgacacccttgcccttggggagg 775976
to top
>gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:92076 IMAGE:7046733), complete cds
          Length = 888

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 262 cacccaaggcttggtgcccttgccaatg 289
           |||||| |||||| ||||||||||||||
Sbjct: 715 cacccatggcttgttgcccttgccaatg 688
to top
>ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1), mRNA
          Length = 2945

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 283  gccaatggtgaacacgttgc 302
            ||||||||||||||||||||
Sbjct: 1770 gccaatggtgaacacgttgc 1789
to top
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
               sequence
          Length = 2300533

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 232     gagcttgatacccttgcccttggg 255
               |||||||| |||||||||||||||
Sbjct: 1677741 gagcttgacacccttgcccttggg 1677718
to top
>gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, complete sequence
          Length = 197827

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 208   cttcctctgctcctcaatga 227
             ||||||||||||||||||||
Sbjct: 23788 cttcctctgctcctcaatga 23769
to top
>gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence
          Length = 160031

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 203   tccctcttcctctgctcctc 222
             ||||||||||||||||||||
Sbjct: 75373 tccctcttcctctgctcctc 75392
to top
>gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, complete sequence
          Length = 184893

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    aaacatccacattacatcta 48
             ||||||||||||||||||||
Sbjct: 87241 aaacatccacattacatcta 87260
to top
>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    ggttccaggaacatagttct 122
              ||||||||||||||||||||
Sbjct: 192051 ggttccaggaacatagttct 192032
to top
>ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNA06200) partial mRNA
          Length = 840

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 232 gagcttgatacccttgcccttggg 255
           |||||||| |||||||||||||||
Sbjct: 738 gagcttgacacccttgcccttggg 715
to top
>gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome 18, complete sequence
          Length = 156239

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   ctcttcctctgctcctcaat 225
             ||||||||||||||||||||
Sbjct: 47354 ctcttcctctgctcctcaat 47335
to top
>ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (rps4x), mRNA
          Length = 888

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 262 cacccaaggcttggtgcccttgccaatg 289
           |||||| |||||| ||||||||||||||
Sbjct: 715 cacccatggcttgttgcccttgccaatg 688
to top
>gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRNA (cDNA clone
           MGC:34152 IMAGE:5198480), complete cds
          Length = 1554

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 169 gaatcaggccttggcagcagcctg 192
           |||||||||||||||||| |||||
Sbjct: 421 gaatcaggccttggcagccgcctg 398
to top
>emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227D1 on chromosome X Contains
             part of the IL1RAPL2 gene for interleukin 1 receptor
             accessory protein-like 2, complete sequence
          Length = 33667

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 355   aaaggttcccttatgcttct 374
             ||||||||||||||||||||
Sbjct: 13597 aaaggttcccttatgcttct 13578
to top
>emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chromosome 10 Contains the
             ALOX5 gene for arachidonate 5-lipoxygenase, a novel gene,
             the 3' end of a gene for cellular modulator of immune
             recognition (c-MIR) and five CpG islands, complete
             sequence
          Length = 129266

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 119   ttctatatccttgcagataactgg 142
             |||||||||||| |||||||||||
Sbjct: 81474 ttctatatccttacagataactgg 81451
to top
>ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predicted mRNA
          Length = 1485

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 208  cttcctctgctcctcaatga 227
            ||||||||||||||||||||
Sbjct: 1026 cttcctctgctcctcaatga 1007
to top
>ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC581083 (LOC581083), mRNA
          Length = 1197

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 203 tccctcttcctctgctcctc 222
           ||||||||||||||||||||
Sbjct: 764 tccctcttcctctgctcctc 745
to top
>emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clone 1a13
          Length = 2945

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 283  gccaatggtgaacacgttgc 302
            ||||||||||||||||||||
Sbjct: 1770 gccaatggtgaacacgttgc 1789
to top
>emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 in linkage group 10,
             complete sequence
          Length = 210640

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   tcttcctctgctcctcaatg 226
             ||||||||||||||||||||
Sbjct: 25208 tcttcctctgctcctcaatg 25189
to top
>gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, complete sequence
          Length = 175223

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 91     cttaaaaaagatggttccag 110
              ||||||||||||||||||||
Sbjct: 158366 cttaaaaaagatggttccag 158385
to top
>gb|AC007437.16| Homo sapiens 12q22 BAC RPCI11-541G9 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 179854

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 254   gggaggctcacccaaggcttggtg 277
             |||||||||||||||| |||||||
Sbjct: 12827 gggaggctcacccaagccttggtg 12850
to top
>gb|AC007656.2| Homo sapiens 12q22 BAC RPCI11-534P6 (Rowswell Park Cancer Institute Human
              BAC Library) complete sequence
          Length = 171236

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 254    gggaggctcacccaaggcttggtg 277
              |||||||||||||||| |||||||
Sbjct: 157441 gggaggctcacccaagccttggtg 157464
to top
>gb|AC150660.4| Mus musculus BAC clone RP23-41F9 from chromosome 15, complete sequence
          Length = 229655

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 319   ctggtgaccctgggcatcct 338
             ||||||||||||||||||||
Sbjct: 49823 ctggtgaccctgggcatcct 49842
to top
>gb|AC133282.7| Mus musculus chromosome 15, clone RP24-408B1, complete sequence
          Length = 183129

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 319   ctggtgaccctgggcatcct 338
             ||||||||||||||||||||
Sbjct: 12843 ctggtgaccctgggcatcct 12824
to top
>dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21, map 22, complete
              sequences
          Length = 203521

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 130844 tagttctatatccttgcaga 130825
to top
>gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, complete sequence
          Length = 260404

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 29   aaacatccacattacatcta 48
            ||||||||||||||||||||
Sbjct: 1569 aaacatccacattacatcta 1550
to top
>emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1078H9 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 228097

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   ctcttcctctgctcctcaat 225
             ||||||||||||||||||||
Sbjct: 63018 ctcttcctctgctcctcaat 62999
to top
>gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein (protease nexin-II,
              Alzheimer disease) (APP) gene, complete cds
          Length = 293960

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 254416 tagttctatatccttgcaga 254435
to top
>gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosome 18, complete
             sequence
          Length = 205253

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   ctcttcctctgctcctcaat 225
             ||||||||||||||||||||
Sbjct: 62232 ctcttcctctgctcctcaat 62251
to top
>dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, section 38/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 325187 tagttctatatccttgcaga 325168
to top
>gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, complete sequence
          Length = 188713

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    aaacatccacattacatcta 48
             ||||||||||||||||||||
Sbjct: 16088 aaacatccacattacatcta 16069
to top
>gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, complete sequence
          Length = 113482

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   ggttccaggaacatagttct 122
             ||||||||||||||||||||
Sbjct: 64196 ggttccaggaacatagttct 64177
to top
>gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, complete sequence
          Length = 150428

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    cttcctctgctcctcaatga 227
              ||||||||||||||||||||
Sbjct: 147440 cttcctctgctcctcaatga 147421
to top
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 208     cttcctctgctcctcaatga 227
               ||||||||||||||||||||
Sbjct: 2525910 cttcctctgctcctcaatga 2525929
to top
>emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chromosome 7, complete
              sequence
          Length = 215366

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 246    tgcccttggggaggctcacc 265
              ||||||||||||||||||||
Sbjct: 213316 tgcccttggggaggctcacc 213297
to top
>emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-661G16 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 162691

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   ctcttcctctgctcctcaat 225
             ||||||||||||||||||||
Sbjct: 27574 ctcttcctctgctcctcaat 27593
to top
>dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL56-APP region, clone
             B2291C14-R44F3, segment 6/10, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   tagttctatatccttgcaga 135
             ||||||||||||||||||||
Sbjct: 24483 tagttctatatccttgcaga 24464
to top
>dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, complete cds
          Length = 301692

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 258129 tagttctatatccttgcaga 258148
to top
>dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:T1715,
            LL56-APP region, complete sequence
          Length = 68001

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 116  tagttctatatccttgcaga 135
            ||||||||||||||||||||
Sbjct: 7611 tagttctatatccttgcaga 7592
to top
>dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related, B2291C14-T1533 region,
              segment 5/7
          Length = 161014

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 124483 tagttctatatccttgcaga 124464


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,685,069
Number of Sequences: 3902068
Number of extensions: 3685069
Number of successful extensions: 78983
Number of sequences better than 10.0: 129
Number of HSP's better than 10.0 without gapping: 129
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78607
Number of HSP's gapped (non-prelim): 371
length of query: 395
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 373
effective length of database: 17,147,199,772
effective search space: 6395905514956
effective search space used: 6395905514956
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top