>gb|BC085717.1| Rattus norvegicus cDNA clone IMAGE:7189598, containing frame-shift
            errors
          Length = 2028

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   tcagcacatccatacccatgg 119
            |||||||||||||||||||||
Sbjct: 1187 tcagcacatccatacccatgg 1167

>gb|BC024809.1| Mus musculus amyloid beta (A4) precursor protein-binding, family B,
            member 3, mRNA (cDNA clone MGC:38710 IMAGE:5357681),
            complete cds
          Length = 2077

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   tcagcacatccatacccatgg 119
            |||||||||||||||||||||
Sbjct: 1252 tcagcacatccatacccatgg 1232

>gb|BC024136.1| Mus musculus mRNA similar to amyloid beta (A4) precursor
            protein-binding, family B, member 3 (cDNA clone
            IMAGE:5136115)
          Length = 2077

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   tcagcacatccatacccatgg 119
            |||||||||||||||||||||
Sbjct: 1250 tcagcacatccatacccatgg 1230

>ref|NM_146085.1| Mus musculus amyloid beta (A4) precursor protein-binding, family B,
            member 3 (Apbb3), mRNA
          Length = 2077

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   tcagcacatccatacccatgg 119
            |||||||||||||||||||||
Sbjct: 1252 tcagcacatccatacccatgg 1232

>dbj|AK141878.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130047F23 product:amyloid beta
            (A4) precursor protein-binding, family B, member 3, full
            insert sequence
          Length = 1944

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   tcagcacatccatacccatgg 119
            |||||||||||||||||||||
Sbjct: 1154 tcagcacatccatacccatgg 1134

>dbj|AK171634.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830001J15 product:amyloid beta (A4)
            precursor protein-binding, family B, member 3, full
            insert sequence
          Length = 2259

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   tcagcacatccatacccatgg 119
            |||||||||||||||||||||
Sbjct: 1445 tcagcacatccatacccatgg 1425

>ref|NM_053957.1| Rattus norvegicus amyloid beta (A4) precursor protein-binding, family
            B, member 3 (Apbb3), mRNA
          Length = 2024

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   tcagcacatccatacccatgg 119
            |||||||||||||||||||||
Sbjct: 1210 tcagcacatccatacccatgg 1190

>emb|BX510324.7| Zebrafish DNA sequence from clone DKEY-18C8 in linkage group 20,
             complete sequence
          Length = 164369

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 27    gggaaaaccaccaatcatggg 47
             |||||||||||||||||||||
Sbjct: 62217 gggaaaaccaccaatcatggg 62237

>emb|Y13413.1|RNY13413 Rattus norvegicus mRNA for Fe65L2 protein
          Length = 2024

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   tcagcacatccatacccatgg 119
            |||||||||||||||||||||
Sbjct: 1210 tcagcacatccatacccatgg 1190

>gb|AC007129.4| Homo sapiens PAC clone RP5-994I4 from 7, complete sequence
          Length = 111103

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    gaaaatattcatgggaaaac 34
             ||||||||||||||||||||
Sbjct: 13882 gaaaatattcatgggaaaac 13901

>emb|AL355580.13| Human DNA sequence from clone RP11-76K10 on chromosome 13 Contains the 3'
              end of a novel gene, complete sequence
          Length = 179497

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     ggaaaatattcatgggaaaa 33
              ||||||||||||||||||||
Sbjct: 109804 ggaaaatattcatgggaaaa 109823

>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome
          Length = 3573470

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 6       gaaacttgggaaaatattca 25
               ||||||||||||||||||||
Sbjct: 1653116 gaaacttgggaaaatattca 1653097

>emb|AL805977.2| Human DNA sequence from clone RP11-491O20 on chromosome 6, complete
             sequence
          Length = 174830

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    gaaaatattcatgggaaaac 34
             ||||||||||||||||||||
Sbjct: 72074 gaaaatattcatgggaaaac 72055

>gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosome 16, complete
             sequence
          Length = 186202

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 83    ttacacctctacagagtca 101
             |||||||||||||||||||
Sbjct: 32125 ttacacctctacagagtca 32107

>gb|AC150546.2| Bos taurus  BAC CH240-77D21 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 203152

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 15    gaaaatattcatgggaaaa 33
             |||||||||||||||||||
Sbjct: 56587 gaaaatattcatgggaaaa 56569

>emb|AL732371.4| Human DNA sequence from clone RP11-2K15 on chromosome X Contains the 5'
              end of the REPS2 gene for RALBP1 associated Eps domain
              containing 2 and a chromobox homolog 5 (HP1 alpha homolog,
              Drosophila) (CBX5) pseudogene, complete sequence
          Length = 185152

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 11     ttgggaaaatattcatgggaaaa 33
              |||||||||||| ||||||||||
Sbjct: 113952 ttgggaaaatatccatgggaaaa 113930

>emb|BX004968.20| Zebrafish DNA sequence from clone DKEY-35I13 in linkage group 15,
              complete sequence
          Length = 208706

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 124    ccttctttcatcagggaaa 142
              |||||||||||||||||||
Sbjct: 111456 ccttctttcatcagggaaa 111438

>gb|AC112910.3| Homo sapiens 3 BAC RP11-273F12 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 115927

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     cccctgaaacttgggaaaa 19
             |||||||||||||||||||
Sbjct: 20938 cccctgaaacttgggaaaa 20920

>gb|AC136742.15| Mus musculus chromosome 5, clone RP23-145H8, complete sequence
          Length = 197131

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     aaacttgggaaaatattca 25
             |||||||||||||||||||
Sbjct: 66240 aaacttgggaaaatattca 66258

>gb|AC020979.6| Homo sapiens chromosome 5 clone RP1_166C2, complete sequence
          Length = 82078

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    tgggaaaatattcatggga 30
             |||||||||||||||||||
Sbjct: 45598 tgggaaaatattcatggga 45616

>gb|AC114802.5| Homo sapiens BAC clone RP11-790N8 from 2, complete sequence
          Length = 154814

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 7      aaacttgggaaaatattca 25
              |||||||||||||||||||
Sbjct: 132851 aaacttgggaaaatattca 132869

>gb|AC079767.7| Homo sapiens BAC clone RP11-196E10 from 2, complete sequence
          Length = 90906

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 124   ccttctttcatcagggaaaacta 146
             ||||||||| |||||||||||||
Sbjct: 49251 ccttctttcttcagggaaaacta 49273

>emb|BX537270.4| Zebrafish DNA sequence from clone DKEY-278E24 in linkage group 4,
             complete sequence
          Length = 175518

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    gaaaatattcatgggaaaa 33
             |||||||||||||||||||
Sbjct: 33530 gaaaatattcatgggaaaa 33548

>gb|AC138397.4| Mus musculus BAC clone RP23-65O11 from 8, complete sequence
          Length = 246976

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 58   agtcaggagctagcagggc 76
            |||||||||||||||||||
Sbjct: 2383 agtcaggagctagcagggc 2401

>gb|AC133202.3| Mus musculus BAC clone RP23-83P19 from 8, complete sequence
          Length = 150932

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    agtcaggagctagcagggc 76
             |||||||||||||||||||
Sbjct: 57359 agtcaggagctagcagggc 57341


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,361,261
Number of Sequences: 3902068
Number of extensions: 1361261
Number of successful extensions: 91510
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91453
Number of HSP's gapped (non-prelim): 57
length of query: 156
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 134
effective length of database: 17,147,199,772
effective search space: 2297724769448
effective search space used: 2297724769448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)