>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 1       tccatccggggataagacat 20
               ||||||||||||||||||||
Sbjct: 2186561 tccatccggggataagacat 2186542

>gb|AC105968.14| Mus musculus chromosome 18, clone RP23-265P4, complete sequence
          Length = 210819

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 84     gcataccttcctgatctct 102
              |||||||||||||||||||
Sbjct: 161538 gcataccttcctgatctct 161520

>gb|AC132351.3| Mus musculus BAC clone RP24-95F24 from chromosome 18, complete sequence
          Length = 186726

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 84    gcataccttcctgatctct 102
             |||||||||||||||||||
Sbjct: 56578 gcataccttcctgatctct 56560

>emb|AL355529.21| Human DNA sequence from clone RP11-85C15 on chromosome 10 Contains the
             5' end of the MKI67 gene for antigen identified by
             monoclonal antibody Ki-67 and three CpG islands, complete
             sequence
          Length = 140466

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 48    actgagtactgaccagcat 66
             |||||||||||||||||||
Sbjct: 75147 actgagtactgaccagcat 75129

>gb|AC016526.6|AC016526 Homo sapiens chromosome 14 clone RP11-361H10 map 14q24.3, complete
              sequence
          Length = 179984

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 70     ttgttgactctccagcata 88
              |||||||||||||||||||
Sbjct: 145752 ttgttgactctccagcata 145734

>gb|AC174769.1| Gasterosteus aculeatus clone VMRC28-49K14, complete sequence
          Length = 135249

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 62    agcattagttgttgactct 80
             |||||||||||||||||||
Sbjct: 24542 agcattagttgttgactct 24524


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 630,983
Number of Sequences: 3902068
Number of extensions: 630983
Number of successful extensions: 45269
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45255
Number of HSP's gapped (non-prelim): 14
length of query: 103
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 82
effective length of database: 17,151,101,840
effective search space: 1406390350880
effective search space used: 1406390350880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)