Clone Name | rbart51f12 |
---|---|
Clone Library Name | barley_pub |
>ref|NM_103621.2| Arabidopsis thaliana phosphoric diester hydrolase/ transcription factor AT1G47270 mRNA, complete cds Length = 1678 Score = 42.1 bits (21), Expect = 0.13 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttct 21 ||||||||||||||||||||| Sbjct: 1173 tcagcggcttcttcttcttct 1153
>ref|XM_471044.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 645 Score = 42.1 bits (21), Expect = 0.13 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttct 21 ||||||||||||||||||||| Sbjct: 550 tcagcggcttcttcttcttct 530
>gb|AF487268.1| Arabidopsis thaliana tubby-like protein TULP6 (TULP6) mRNA, complete cds Length = 1167 Score = 42.1 bits (21), Expect = 0.13 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttct 21 ||||||||||||||||||||| Sbjct: 826 tcagcggcttcttcttcttct 806
>emb|AL606631.2|OSJN00069 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0050O03, complete sequence Length = 140948 Score = 42.1 bits (21), Expect = 0.13 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 tcagcggcttcttcttcttct 21 ||||||||||||||||||||| Sbjct: 66795 tcagcggcttcttcttcttct 66815
>gb|AY191156.1| Pediculus humanus capitis from Ecuador voltage-sensitive sodium channel alpha-subunit mRNA, complete cds Length = 6156 Score = 42.1 bits (21), Expect = 0.13 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttct 21 ||||||||||||||||||||| Sbjct: 1301 tcagcggcttcttcttcttct 1281
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 0.13 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 tcagcggcttcttcttcttct 21 ||||||||||||||||||||| Sbjct: 987076 tcagcggcttcttcttcttct 987096
>gb|AC079677.4|AC079677 Arabidopsis thaliana chromosome 1 BAC F8G22 genomic sequence, complete sequence Length = 42801 Score = 42.1 bits (21), Expect = 0.13 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 tcagcggcttcttcttcttct 21 ||||||||||||||||||||| Sbjct: 2100 tcagcggcttcttcttcttct 2120
>dbj|AB090951.1| Pediculus humanus humanus para mRNA for para-orthologous sodium channel alpha-subunit, complete cds Length = 6521 Score = 42.1 bits (21), Expect = 0.13 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttct 21 ||||||||||||||||||||| Sbjct: 1458 tcagcggcttcttcttcttct 1438
>gb|AC164431.2| Mus musculus BAC clone RP23-430N15 from chromosome 17, complete sequence Length = 190724 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Plus Query: 2 cagcggcttcttcttcttct 21 |||||||||||||||||||| Sbjct: 108686 cagcggcttcttcttcttct 108705
>gb|AC123030.4| Mus musculus BAC clone RP24-573I5 from chromosome 7, complete sequence Length = 173971 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Plus Query: 2 cagcggcttcttcttcttct 21 |||||||||||||||||||| Sbjct: 68092 cagcggcttcttcttcttct 68111
>gb|AY205612.1| Glycine max cultivar Williams 82 SIRE1-13 retroelement, partial sequence Length = 9161 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttc 20 |||||||||||||||||||| Sbjct: 8320 tcagcggcttcttcttcttc 8301
>ref|XM_781825.1| PREDICTED: Strongylocentrotus purpuratus similar to microfibrillar-associated protein 1 (LOC581844), partial mRNA Length = 666 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttc 20 |||||||||||||||||||| Sbjct: 473 tcagcggcttcttcttcttc 454
>ref|XM_783190.1| PREDICTED: Strongylocentrotus purpuratus similar to CG1017-PA (LOC583272), mRNA Length = 1518 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttc 20 |||||||||||||||||||| Sbjct: 473 tcagcggcttcttcttcttc 454
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Plus Query: 2 cagcggcttcttcttcttct 21 |||||||||||||||||||| Sbjct: 29268 cagcggcttcttcttcttct 29287 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 24268464 gcggcttcttcttcttct 24268481
>gb|AC013258.5|AC013258 Arabidopsis thaliana chromosome 1 BAC F9E10 genomic sequence, complete sequence Length = 97263 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttc 20 |||||||||||||||||||| Sbjct: 39789 tcagcggcttcttcttcttc 39770
>gb|AC008263.2|F25A4 Arabidopsis thaliana chromosome 1 BAC F25A4 sequence, complete sequence Length = 115721 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttc 20 |||||||||||||||||||| Sbjct: 11452 tcagcggcttcttcttcttc 11433
>gb|AF053008.1|AF053008 Glycine max env pseudogene, partial sequence; uncharacterized long terminal repeat, complete sequence; gag-pol polyprotein (pol) gene, complete cds; and envelope-like gene, partial cds Length = 8301 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttc 20 |||||||||||||||||||| Sbjct: 557 tcagcggcttcttcttcttc 538
>gb|U96295.1|GMU96295 Glycine max partial SIRE-1 sequence ribonuclease H and envelope-like genes, partial cds, and long terminal repeat, complete sequence Length = 4190 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttcttc 20 |||||||||||||||||||| Sbjct: 2054 tcagcggcttcttcttcttc 2035
>emb|CT010583.8| Mouse DNA sequence from clone RP23-203B24 on chromosome 16, complete sequence Length = 234878 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Plus Query: 2 cagcggcttcttcttcttct 21 |||||||||||||||||||| Sbjct: 112203 cagcggcttcttcttcttct 112222
>gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete genome Length = 2905187 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Minus Query: 2 cagcggcttcttcttcttct 21 |||||||||||||||||||| Sbjct: 2632260 cagcggcttcttcttcttct 2632241
>gb|AC073405.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0036D10, complete sequence Length = 156772 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Plus Query: 2 cagcggcttcttcttcttct 21 |||||||||||||||||||| Sbjct: 29268 cagcggcttcttcttcttct 29287
>gb|AC152969.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0098I11, complete sequence Length = 122970 Score = 40.1 bits (20), Expect = 0.51 Identities = 20/20 (100%) Strand = Plus / Plus Query: 2 cagcggcttcttcttcttct 21 |||||||||||||||||||| Sbjct: 38497 cagcggcttcttcttcttct 38516
>gb|BC072135.1| Xenopus laevis cDNA clone MGC:79979 IMAGE:4680226, complete cds Length = 2050 Score = 38.2 bits (19), Expect = 2.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 2 cagcggcttcttcttcttc 20 ||||||||||||||||||| Sbjct: 804 cagcggcttcttcttcttc 786
>ref|XM_387315.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07139.1) partial mRNA Length = 3519 Score = 38.2 bits (19), Expect = 2.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 2 cagcggcttcttcttcttc 20 ||||||||||||||||||| Sbjct: 181 cagcggcttcttcttcttc 163
>ref|XM_778466.1| PREDICTED: Strongylocentrotus purpuratus similar to lipoxygenase homology domains 1 (LOC578288), mRNA Length = 2379 Score = 38.2 bits (19), Expect = 2.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 tcagcggcttcttcttctt 19 ||||||||||||||||||| Sbjct: 295 tcagcggcttcttcttctt 277
>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 Length = 2661830 Score = 38.2 bits (19), Expect = 2.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 3 agcggcttcttcttcttct 21 ||||||||||||||||||| Sbjct: 510378 agcggcttcttcttcttct 510360
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 38.2 bits (19), Expect = 2.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 3 agcggcttcttcttcttct 21 ||||||||||||||||||| Sbjct: 99244 agcggcttcttcttcttct 99262
>dbj|AP006059.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0023E08 Length = 127560 Score = 38.2 bits (19), Expect = 2.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 3 agcggcttcttcttcttct 21 ||||||||||||||||||| Sbjct: 99244 agcggcttcttcttcttct 99262
>dbj|AK072386.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023081P06, full insert sequence Length = 2145 Score = 38.2 bits (19), Expect = 2.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 3 agcggcttcttcttcttct 21 ||||||||||||||||||| Sbjct: 262 agcggcttcttcttcttct 244
>gb|M94969.1|XELXLAN Xenopus laevis animal 4 (Xlan4) mRNA, complete cds Length = 2425 Score = 38.2 bits (19), Expect = 2.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 2 cagcggcttcttcttcttc 20 ||||||||||||||||||| Sbjct: 1165 cagcggcttcttcttcttc 1147
>ref|NM_179067.1| Arabidopsis thaliana RPP5 (RECOGNITION OF PERONOSPORA PARASITICA 5) AT4G16950 (RPP5) transcript variant AT4G16950.2 mRNA, complete cds Length = 4706 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 131 gcggcttcttcttcttct 148
>ref|NM_117798.2| Arabidopsis thaliana RPP5 (RECOGNITION OF PERONOSPORA PARASITICA 5) AT4G16950 (RPP5) transcript variant AT4G16950.1 mRNA, complete cds Length = 4685 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 131 gcggcttcttcttcttct 148
>ref|NM_147984.1| Arabidopsis thaliana unknown protein AT5G32605 mRNA, complete cds Length = 1098 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 134 gcggcttcttcttcttct 117
>ref|NM_111791.2| Arabidopsis thaliana unknown protein AT3G09570 mRNA, complete cds Length = 1664 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 1361 gcggcttcttcttcttct 1344
>ref|NM_194553.1| Oryza sativa (japonica cultivar-group) putative peroxidase (OSJNBa0015O22.19), mRNA Length = 1011 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 4 gcggcttcttcttcttct 21
>gb|AC105995.9| Mus musculus chromosome 5, clone RP24-168A7, complete sequence Length = 150133 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 58220 gcggcttcttcttcttct 58237
>gb|AF136278.1| Mus musculus rpl30 pseudogene, complete sequence; cathepsin Z (Ctsz) gene, complete cds; and TH1 pseudogene, complete sequence Length = 17566 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 2191 gcggcttcttcttcttct 2174
>gb|AY022280.1| Oryza sativa microsatellite MRG4605 containing (AAG)X8, genomic sequence Length = 224 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 128 gcggcttcttcttcttct 111
>gb|AC120885.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0042J05, complete sequence Length = 150295 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 79070 gcggcttcttcttcttct 79087
>gb|AC140420.4| Mus musculus BAC clone RP24-440F22 from chromosome 5, complete sequence Length = 157377 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 148873 gcggcttcttcttcttct 148890
>gb|BT013160.1| Lycopersicon esculentum clone 134192F, mRNA sequence Length = 1488 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 20 gcggcttcttcttcttct 37
>gb|AC147678.5| Canis Familiaris, clone XX-25C7, complete sequence Length = 171041 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 38487 gcggcttcttcttcttct 38504
>gb|AC108523.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_C04, complete sequence Length = 96328 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 34200 gcggcttcttcttcttct 34217
>gb|AC113262.29| Mus musculus strain 129/Sv clone ct7-518k21 map 5, complete sequence Length = 180394 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 90371 gcggcttcttcttcttct 90354
>gb|AY551921.1| Oryza sativa (japonica cultivar-group) MADS-box protein RMADS216 mRNA, complete cds Length = 1265 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 195 gcggcttcttcttcttct 178
>gb|BC047253.1| Xenopus laevis nonmuscle myosin II heavy chain A, mRNA (cDNA clone IMAGE:5570568), partial cds Length = 3873 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 agcggcttcttcttcttc 20 |||||||||||||||||| Sbjct: 2997 agcggcttcttcttcttc 2980
>gb|AC110249.10| Mus musculus chromosome 14, clone RP23-257O8, complete sequence Length = 204244 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 2392 gcggcttcttcttcttct 2375
>gb|AC132608.2| Mus musculus BAC clone RP23-451E12 from chromosome 18, complete sequence Length = 201478 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 34587 gcggcttcttcttcttct 34604
>emb|CR974589.6| Mouse DNA sequence from clone RP23-77B14 on chromosome 12, complete sequence Length = 198849 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 61294 gcggcttcttcttcttct 61277
>gb|AC130549.4| Mus musculus BAC clone RP24-456I3 from chromosome 7, complete sequence Length = 160449 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 85224 gcggcttcttcttcttct 85207
>gb|AC132620.3| Mus musculus BAC clone RP23-179A12 from chromosome 6, complete sequence Length = 178174 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 59936 gcggcttcttcttcttct 59919
>gb|AC121808.2| Mus musculus BAC clone RP23-449M23 from 13, complete sequence Length = 194020 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 121980 gcggcttcttcttcttct 121963
>gb|AC114555.7| Mus musculus chromosome 5, clone RP23-431C18, complete sequence Length = 162394 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 59592 gcggcttcttcttcttct 59575
>gb|AY286492.1| Danio rerio prickle1 mRNA, complete cds Length = 2698 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 2218 gcggcttcttcttcttct 2201
>gb|AC118543.30| Mus musculus strain C57BL/6J clone rp23-254b17 map 17, complete sequence Length = 241570 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 52216 gcggcttcttcttcttct 52199
>gb|DQ132648.1| Arabidopsis thaliana clone 01410 expressed protein (At1g11990) mRNA, complete cds Length = 1963 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 1055 gcggcttcttcttcttct 1072
>gb|DQ132647.1| Arabidopsis thaliana clone 01409 expressed protein (At1g11990) mRNA, complete cds Length = 2184 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 1293 gcggcttcttcttcttct 1310
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence Length = 2331000 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 637812 gcggcttcttcttcttct 637795
>emb|Z97342.2|ATFCA7 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 7 Length = 201471 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 107199 gcggcttcttcttcttct 107182
>gb|BT023749.1| Drosophila melanogaster RH73753 full insert cDNA Length = 2349 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 1953 gcggcttcttcttcttct 1970
>emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on chromosome 11 Contains the 5' end of the Lpo gene for lactoperoxidase, a novel gene, the Epx gene for eosinophil peroxidase, the Olfr462, Olfr463 and Olfr464 genes for olfactory receptors 462, 463 and 464, a novel gene, a cytochrome c oxidase subunit VIc (Cox6c) pseudogene, a ubiquitin-conjugating enzyme E2B (S. cerevisiae RAD6 homology) (Ube2b) pseudogene and the 3' end of the gene for dynein light chain 2 (6720463E02Rik), complete sequence Length = 184069 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 132244 gcggcttcttcttcttct 132261
>gb|AC004938.3| Homo sapiens PAC clone RP5-971C3 from 7, complete sequence Length = 88029 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 42495 gcggcttcttcttcttct 42512
>emb|AL606466.12| Mouse DNA sequence from clone RP23-348N2 on chromosome 11 Contains the 5' end of the Ppp3r1 gene for protein phospatase 3 regulatory subunit B alpha isoform (calcineurin B, type I), a ribosomal protein L39 (Rpl39) pseudogene, a novel gene, the Plek gene for pleckstrin, a CUB domain and EGF-like repeat containing (Cegf) protein pseudogene and a CpG island, complete sequence Length = 201805 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 118756 gcggcttcttcttcttct 118773
>emb|AL161545.2|ATCHRIV45 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 45 Length = 199548 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 93028 gcggcttcttcttcttct 93011
>emb|AJ544892.1|TNI544892 Tetraodon nigroviridis crfb1 gene, crfb2 gene, crfb3 gene, crfb4 gene, crfb5 gene, crfb6 gene and ORF1 DNA Length = 30094 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 24648 gcggcttcttcttcttct 24665
>gb|AY278986.1| Danio rerio Prickle1 (pk1) mRNA, complete cds Length = 2382 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 2037 gcggcttcttcttcttct 2020
>gb|AC164315.2| Mus musculus BAC clone RP23-18J12 from chromosome 14, complete sequence Length = 204011 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 57732 gcggcttcttcttcttct 57749
>gb|AF067624.1| Caenorhabditis elegans cosmid M01B12, complete sequence Length = 34907 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 13649 gcggcttcttcttcttct 13632
>gb|AC023728.5| Drosophila melanogaster X BAC RP98-6J12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 175674 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 154887 gcggcttcttcttcttct 154904
>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 Length = 2505489 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 agcggcttcttcttcttc 20 |||||||||||||||||| Sbjct: 1840601 agcggcttcttcttcttc 1840584
>gb|AC068654.2| Genomic Sequence For Oryza sativa (japonica cultivar-group) cultivar Nipponbare Clone OSJNBa0015O22 From Chromosome 10, complete sequence Length = 189349 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 105420 gcggcttcttcttcttct 105403
>ref|XM_682272.1| PREDICTED: Danio rerio similar to dentin sialophosphoprotein preproprotein (LOC558975), mRNA Length = 1822 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 1403 gcggcttcttcttcttct 1386
>ref|NM_183342.2| Danio rerio prickle-like 1 (Drosophila) (prickle1), mRNA Length = 2698 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 2218 gcggcttcttcttcttct 2201
>gb|BT006586.1| Arabidopsis thaliana At3g09570 mRNA, complete cds Length = 1320 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 1283 gcggcttcttcttcttct 1266
>dbj|AK088695.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430023N08 product:unclassifiable, full insert sequence Length = 2332 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 2194 gcggcttcttcttcttct 2211
>gb|AC153905.5| Mus musculus 6 BAC RP23-215A7 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 215955 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 102004 gcggcttcttcttcttct 101987
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 23063067 gcggcttcttcttcttct 23063084
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 637812 gcggcttcttcttcttct 637795
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 26500132 gcggcttcttcttcttct 26500115 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 25729263 gcggcttcttcttcttct 25729280
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 agcggcttcttcttcttc 20 |||||||||||||||||| Sbjct: 29015841 agcggcttcttcttcttc 29015824
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 20075991 gcggcttcttcttcttct 20076008
>gb|AC016661.7|AC016661 Arabidopsis thaliana chromosome 3 BAC F11F8 genomic sequence, complete sequence Length = 107603 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 40179 gcggcttcttcttcttct 40162
>emb|BX823641.1|CNS0A5CD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS60ZB11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1536 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 1298 gcggcttcttcttcttct 1281
>gb|AC126599.10| Mus musculus chromosome 3, clone RP24-487F9, complete sequence Length = 186281 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 143537 gcggcttcttcttcttct 143554
>gb|AC155640.5| Mus musculus 10 BAC RP24-87H21 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 222712 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 33086 gcggcttcttcttcttct 33103
>gb|AC146064.4| Pan troglodytes BAC clone RP43-59B14 from chromosome 7, complete sequence Length = 186687 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 76773 gcggcttcttcttcttct 76756
>gb|AF180942.1|ATRPP5LE2 Arabidopsis thaliana RPP5 disease resistance locus, main contig Length = 91660 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 77315 gcggcttcttcttcttct 77332 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 25826 gcggcttcttcttcttct 25843
>gb|AC012074.9| Homo sapiens BAC clone RP11-458N5 from 2, complete sequence Length = 197652 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 2 cagcggcttcttcttctt 19 |||||||||||||||||| Sbjct: 1985 cagcggcttcttcttctt 2002
>gb|BT002532.1| Arabidopsis thaliana unknown protein (At3g09570) mRNA, complete cds Length = 1550 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 1352 gcggcttcttcttcttct 1335
>gb|AF296826.1|F15I15 Arabidopsis thaliana BAC F15I15 Length = 93896 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 14640 gcggcttcttcttcttct 14657
>gb|AC140397.2| Mus musculus BAC clone RP23-162E7 from chromosome 13, complete sequence Length = 233829 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 119781 gcggcttcttcttcttct 119798
>dbj|AP003726.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0596H10 Length = 166570 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 agcggcttcttcttcttc 20 |||||||||||||||||| Sbjct: 30828 agcggcttcttcttcttc 30811
>dbj|AP004622.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0689E12 Length = 147516 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 1474 gcggcttcttcttcttct 1491
>dbj|AP004847.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1298_H07 Length = 106434 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 24514 gcggcttcttcttcttct 24531
>dbj|AP005529.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0702E04 Length = 190948 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 48999 gcggcttcttcttcttct 48982
>dbj|AB046435.1| Arabidopsis thaliana DNA, chromosome 5 centromere region, clone:F15I15 Length = 93896 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 14640 gcggcttcttcttcttct 14657
>dbj|AP004708.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0700D12 Length = 145177 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 107011 gcggcttcttcttcttct 107028
>gb|AY924664.1| Arabidopsis thaliana hypothetical protein (At1g11990) mRNA, complete cds Length = 1032 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 316 gcggcttcttcttcttct 333
>dbj|AK104730.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-C06, full insert sequence Length = 1447 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 63 gcggcttcttcttcttct 80
>dbj|AK101654.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033057E24, full insert sequence Length = 926 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 764 gcggcttcttcttcttct 747
>dbj|AK061462.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-B11, full insert sequence Length = 1447 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 63 gcggcttcttcttcttct 80
>tpe|BN000654.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-group) prx125 gene for class III peroxidase 125 precursor, exons 1-3 Length = 2806 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 4 gcggcttcttcttcttct 21
>gb|AE003440.3| Drosophila melanogaster chromosome X, section 24 of 74 of the complete sequence Length = 342195 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 20255 gcggcttcttcttcttct 20272
>gb|AY642926.1| Hordeum vulgare BAC CC24_14, complete sequence Length = 184425 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 119910 gcggcttcttcttcttct 119927
>gb|AC123676.9| Mus musculus chromosome 1, clone RP23-275F9, complete sequence Length = 169201 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 128017 gcggcttcttcttcttct 128034
>gb|AF055895.1|AF055895 Xenopus laevis nonmuscle myosin II heavy chain A mRNA, complete cds Length = 6974 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 agcggcttcttcttcttc 20 |||||||||||||||||| Sbjct: 2962 agcggcttcttcttcttc 2945
>gb|AC079082.39| Mus musculus strain C57BL/6J chromosome 10 clone rp23-161b11, complete sequence Length = 205621 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 187660 gcggcttcttcttcttct 187677
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 637809 gcggcttcttcttcttct 637792
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 23372977 gcggcttcttcttcttct 23372994
>emb|AL645602.14| Mouse DNA sequence from clone RP23-79E13 on chromosome 11, complete sequence Length = 240483 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 166461 gcggcttcttcttcttct 166478
>gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complete sequence Length = 180886 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 133493 gcggcttcttcttcttct 133476
>gb|AC141469.4| Mus musculus BAC clone RP24-439P5 from 5, complete sequence Length = 183468 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 45080 gcggcttcttcttcttct 45063
>gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 sequence, complete sequence Length = 123386 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 67491 gcggcttcttcttcttct 67508
>gb|AC132435.3| Mus musculus BAC clone RP23-223L12 from 10, complete sequence Length = 198383 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 157179 gcggcttcttcttcttct 157196 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 157000 gcggcttcttcttcttct 157017
>gb|AC134604.5| Mus musculus BAC clone RP23-296I5 from 12, complete sequence Length = 203284 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 85226 gcggcttcttcttcttct 85209
>gb|BC110971.1| Xenopus laevis cDNA clone IMAGE:4058308, partial cds Length = 3871 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 agcggcttcttcttcttc 20 |||||||||||||||||| Sbjct: 2995 agcggcttcttcttcttc 2978
>emb|AL808026.10| Mouse DNA sequence from clone RP23-200N16 on chromosome X, complete sequence Length = 214016 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 9939 gcggcttcttcttcttct 9922
>emb|AL935200.9| Zebrafish DNA sequence from clone CH211-237I5, complete sequence Length = 160710 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 19804 gcggcttcttcttcttct 19821
>emb|AL928813.10| Mouse DNA sequence from clone RP23-325P5 on chromosome 2, complete sequence Length = 151207 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 118962 gcggcttcttcttcttct 118945
>emb|CT025573.9| Mouse DNA sequence from clone RP24-274P18 on chromosome 17, complete sequence Length = 210893 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 88225 gcggcttcttcttcttct 88208
>emb|AL669982.10| Mouse DNA sequence from clone RP23-297N24 on chromosome 4, complete sequence Length = 240125 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 141551 gcggcttcttcttcttct 141534
>gb|AC158530.2| Mus musculus BAC clone RP23-255H12 from chromosome 17, complete sequence Length = 154287 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 84551 gcggcttcttcttcttct 84534
>emb|AL731703.16| Mouse DNA sequence from clone RP23-100O16 on chromosome 2, complete sequence Length = 187541 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 126559 gcggcttcttcttcttct 126542
>emb|AJ507036.1|TGO507036 Toxoplasma gondii mRNA for GPI transamidase 8 (gpi8 gene) Length = 1815 Score = 36.2 bits (18), Expect = 8.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 gcggcttcttcttcttct 21 |||||||||||||||||| Sbjct: 31 gcggcttcttcttcttct 48 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,275,687 Number of Sequences: 3902068 Number of extensions: 1275687 Number of successful extensions: 869377 Number of sequences better than 10.0: 124 Number of HSP's better than 10.0 without gapping: 125 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 864609 Number of HSP's gapped (non-prelim): 4768 length of query: 56 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 36 effective length of database: 17,155,003,908 effective search space: 617580140688 effective search space used: 617580140688 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)