>gb|AC003983.1|AC003983 Human PAC clone RP1-93I3 from Xq23, complete sequence
          Length = 105563

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 18   ttacatcacttgaaatatt 36
            |||||||||||||||||||
Sbjct: 7357 ttacatcacttgaaatatt 7375

>ref|NM_121050.1| Arabidopsis thaliana transcription factor AT5G10120 mRNA, complete
            cds
          Length = 1416

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 29   gaaatattccatccaatt 46
            ||||||||||||||||||
Sbjct: 1197 gaaatattccatccaatt 1180

>gb|AC111134.10| Mus musculus chromosome 3, clone RP23-349J3, complete sequence
          Length = 223171

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 17    cttacatcacttgaaatattcc 38
             ||||||||||||||| ||||||
Sbjct: 59227 cttacatcacttgaattattcc 59248

>gb|AC153580.19| Mus musculus 6 BAC RP23-389F23 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 180936

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 27    ttgaaatattccatccaa 44
             ||||||||||||||||||
Sbjct: 10035 ttgaaatattccatccaa 10018

>gb|AC147243.2| Mus musculus BAC clone RP23-444P22 from chromosome 6, complete sequence
          Length = 181025

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     atcacttgaaatattcca 39
              ||||||||||||||||||
Sbjct: 144110 atcacttgaaatattcca 144093

>gb|AC125175.4| Mus musculus BAC clone RP24-572I8 from chromosome 6, complete sequence
          Length = 167991

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 22    atcacttgaaatattcca 39
             ||||||||||||||||||
Sbjct: 14965 atcacttgaaatattcca 14948

>gb|AY434099.1| Papio anubis anubis 10.6a-1 MHC class Ib antigen (Paan-AG) mRNA,
           partial cds
          Length = 1137

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 149 acgacggcagggattacatcac 170

>gb|AY055038.1| Papio cynocephalus anubis MHC class I antigen (Paan-AG) mRNA,
           Paan-AG*1 allele, partial cds
          Length = 687

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 157 acgacggcagggattacatcac 178

>gb|AY055037.1| Papio cynocephalus anubis MHC class I antigen (Paan-AG) mRNA,
           Paan-AG*1 allele, partial cds
          Length = 687

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 157 acgacggcagggattacatcac 178

>gb|AY055035.1| Papio cynocephalus anubis MHC class I antigen (Paan-AG) mRNA,
           Paan-AG*1 allele, partial cds
          Length = 687

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 157 acgacggcagggattacatcac 178

>gb|AY055034.1| Papio cynocephalus anubis MHC class I antigen (Paan-AG) mRNA,
           Paan-AG*1 allele, partial cds
          Length = 686

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 157 acgacggcagggattacatcac 178

>gb|AY055033.1| Papio cynocephalus anubis MHC class I antigen (Paan-AG) mRNA,
           Paan-AG*1 allele, partial cds
          Length = 687

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 157 acgacggcagggattacatcac 178

>gb|AY055032.1| Papio cynocephalus anubis MHC class I antigen (Paan-AG) mRNA,
           Paan-AG*1 allele, partial cds
          Length = 686

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 157 acgacggcagggattacatcac 178

>gb|AY055031.1| Papio cynocephalus anubis MHC class I antigen (Paan-AG) mRNA,
           Paan-AG*1 allele, partial cds
          Length = 686

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 157 acgacggcagggattacatcac 178

>gb|AY055030.1| Papio cynocephalus anubis MHC class I antigen (Paan-AG) mRNA,
           Paan-AG*1 allele, partial cds
          Length = 687

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 158 acgacggcagggattacatcac 179

>gb|AY055029.1| Papio cynocephalus anubis MHC class I antigen (Paan-AG) mRNA,
           Paan-AG*1 allele, partial cds
          Length = 687

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 158 acgacggcagggattacatcac 179

>gb|AC110062.4| Homo sapiens chromosome 18, clone CTD-2125N24, complete sequence
          Length = 139550

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    tacatcacttgaaatatt 36
             ||||||||||||||||||
Sbjct: 64434 tacatcacttgaaatatt 64417

>gb|AC153372.5| Mus musculus 6 BAC RP23-358G19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 230623

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 27    ttgaaatattccatccaa 44
             ||||||||||||||||||
Sbjct: 39071 ttgaaatattccatccaa 39088

>dbj|AK008379.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010110G14
           product:unclassifiable, full insert sequence
          Length = 526

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 17  cttacatcacttgaaatattcc 38
           ||||||||||||||| ||||||
Sbjct: 289 cttacatcacttgaattattcc 268

>gb|AF059191.1|AF059191 Papio hamadryas anubis MHC class I antigen Paan-AG mRNA (Paan-AG*01
           allele), partial cds
          Length = 1113

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 5   acgacggcagggcttacatcac 26
           |||||||||||| |||||||||
Sbjct: 409 acgacggcagggattacatcac 430

>dbj|AP002856.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-816H13, complete
              sequence
          Length = 227942

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 18     ttacatcacttgaaatat 35
              ||||||||||||||||||
Sbjct: 172861 ttacatcacttgaaatat 172878

>emb|AL356332.1|ATT31P16 Arabidopsis thaliana DNA chromosome 5, BAC clone T31P16 (ESSA project)
          Length = 80088

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 29    gaaatattccatccaatt 46
             ||||||||||||||||||
Sbjct: 35625 gaaatattccatccaatt 35608


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 345,046
Number of Sequences: 3902068
Number of extensions: 345046
Number of successful extensions: 87968
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87931
Number of HSP's gapped (non-prelim): 37
length of query: 47
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 27
effective length of database: 17,155,003,908
effective search space: 463185105516
effective search space used: 463185105516
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)