>emb|AL080248.7|HSBA19D2 Human DNA sequence from clone RP11-19D2 on chromosome 20 Contains the a
              novel gene and the 5' end of a novel gene, complete
              sequence
          Length = 166913

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 21     gaaatgggaatattctctcca 41
              |||||||||||||||||||||
Sbjct: 159608 gaaatgggaatattctctcca 159628

>emb|Z95400.2|HS393P23 Human DNA sequence from clone RP3-393P23 on chromosome Xq21.1-21.33
             Contains the 5' end of the KLHL4 gene for kelch-like 4
             (Drosophila), complete sequence
          Length = 133120

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 69    tacatggtcccagccttcaaa 89
             |||||||||||||||||||||
Sbjct: 13629 tacatggtcccagccttcaaa 13609

>emb|AL049610.9|HS1055C14 Human DNA sequence from clone RP5-1055C14 on chromosome Xq22.1-22.3
             Contains the TCEAL1 gene for transcription elongation
             factor A (SII)-like 1, a novel gene, a novel pseudogene
             (LOC139779), the MORF4L2 gene for mortality factor 4 like
             2, a novel gene, the 3' end of a gene for the possible
             ortholog of mouse glycine receptor alpha 4 subunit (GLRA4)
             and a novel gene (MGC39655), complete sequence
          Length = 100269

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 72    atggtcccagccttcaaagga 92
             |||||||||||||||||||||
Sbjct: 73151 atggtcccagccttcaaagga 73171

>emb|AL935052.8| Zebrafish DNA sequence from clone CH211-168J10 in linkage group 12,
             complete sequence
          Length = 133195

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 89    aggatttcaaggaacaaataa 109
             |||||||||||||||||||||
Sbjct: 13447 aggatttcaaggaacaaataa 13427

>gb|AC170580.3| Medicago truncatula chromosome 7 BAC clone mte1-32m6, complete sequence
          Length = 44332

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 151   acaattaggcacaaattcttctatt 175
             ||||||||||||||| |||||||||
Sbjct: 19905 acaattaggcacaaaatcttctatt 19881

>gb|AY769950.1| Homo sapiens coagulation factor VIII, procoagulant component (hemophilia
              A) (F8) gene, complete cds
          Length = 192029

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 244    ttcatgtattgttctcctcatttt 267
              ||||||||||||| ||||||||||
Sbjct: 161258 ttcatgtattgttttcctcatttt 161281

>gb|AC139324.4| Mus musculus chromosome 18 clone RP24-393N23, complete sequence
          Length = 180267

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    aaggaacaaataaatggccc 116
             ||||||||||||||||||||
Sbjct: 85358 aaggaacaaataaatggccc 85339

>ref|XM_416707.1| PREDICTED: Gallus gallus similar to GC-rich sequence DNA-binding
            factor homolog (LOC418499), mRNA
          Length = 2554

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 253  tgttctcctcattttttgcaacaatgcc 280
            ||||||||||||| || |||||||||||
Sbjct: 1026 tgttctcctcattcttagcaacaatgcc 999

>ref|NG_005114.1| Homo sapiens coagulation factor VIII region (F8@) on chromosome X
          Length = 652898

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 244   ttcatgtattgttctcctcatttt 267
             ||||||||||||| ||||||||||
Sbjct: 29305 ttcatgtattgttttcctcatttt 29282

>ref|XM_975795.1| PREDICTED: Mus musculus membrane protein, palmitoylated 7 (MAGUK p55
            subfamily member 7), transcript variant 3 (Mpp7), mRNA
          Length = 1930

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 97   aaggaacaaataaatggccc 116
            ||||||||||||||||||||
Sbjct: 1902 aaggaacaaataaatggccc 1921

>ref|XM_896336.2| PREDICTED: Mus musculus membrane protein, palmitoylated 7 (MAGUK p55
            subfamily member 7), transcript variant 4 (Mpp7), mRNA
          Length = 1930

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 97   aaggaacaaataaatggccc 116
            ||||||||||||||||||||
Sbjct: 1902 aaggaacaaataaatggccc 1921

>ref|XM_919224.2| PREDICTED: Mus musculus membrane protein, palmitoylated 7 (MAGUK p55
            subfamily member 7), transcript variant 9 (Mpp7), mRNA
          Length = 1930

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 97   aaggaacaaataaatggccc 116
            ||||||||||||||||||||
Sbjct: 1902 aaggaacaaataaatggccc 1921

>emb|CT025637.1| Pan troglodytes chromosome X clone PTB-011B24 map Xq28, complete sequence
          Length = 261577

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 244    ttcatgtattgttctcctcatttt 267
              ||||||||||||| ||||||||||
Sbjct: 143781 ttcatgtattgttttcctcatttt 143758

>gb|AC134570.5| Mus musculus BAC clone RP24-252B18 from chromosome 18, complete
             sequence
          Length = 183551

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    caagaaatgggaatattctc 37
             ||||||||||||||||||||
Sbjct: 93251 caagaaatgggaatattctc 93270

>emb|BX842559.3| Human DNA sequence from clone CTD-2183H9 on chromosome X Contains
            part of the F8 gene for coagulation factor VIII,
            procoagulant component (hemophilia A), a eukaryotic
            translation elongation factor 1 alpha 1 (EEF1A1)
            pseudogene, a zinc finger-like protein 9 (ZPR)
            pseudogene, the H2AFB gene for H2A histone family member
            B and the F8A gene for coagulation factor VIII-associated
            (intronic transcript), complete sequence
          Length = 68997

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 244  ttcatgtattgttctcctcatttt 267
            ||||||||||||| ||||||||||
Sbjct: 2082 ttcatgtattgttttcctcatttt 2059

>emb|AL596329.5| Human DNA sequence from clone RP11-179D6 on chromosome 13, complete
             sequence
          Length = 85563

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 223   agatgcggcatgcccatctc 242
             ||||||||||||||||||||
Sbjct: 32825 agatgcggcatgcccatctc 32806

>emb|AL442127.7| Human DNA sequence from clone RP11-297I6 on chromosome 13 Contains two
              novel genes, the 5' end of the EFNB2 gene for ephrin-B2
              (HTKL EPLG5 LERK5), an ATP synthase H+ transporting
              mitochondrial F0 complex subunit c pseudogene and two CpG
              islands, complete sequence
          Length = 210115

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 91     gatttcaaggaacaaataaa 110
              ||||||||||||||||||||
Sbjct: 184245 gatttcaaggaacaaataaa 184226

>emb|AL357394.11| Human DNA sequence from clone RP11-469B13 on chromosome 10, complete
              sequence
          Length = 185850

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    tgattgttgtctccaagatg 227
              ||||||||||||||||||||
Sbjct: 107739 tgattgttgtctccaagatg 107720

>gb|AC021010.8| Homo sapiens, clone RP11-69D2, complete sequence
          Length = 187599

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 101    aacaaataaatggcccaaat 120
              ||||||||||||||||||||
Sbjct: 167962 aacaaataaatggcccaaat 167943

>gb|AC163771.5| Pan troglodytes BAC clone CH251-57G17 from chromosome unknown, complete
              sequence
          Length = 179603

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 244    ttcatgtattgttctcctcatttt 267
              ||||||||||||| ||||||||||
Sbjct: 128522 ttcatgtattgttttcctcatttt 128545

>dbj|AK033081.1| Mus musculus 15 days embryo male testis cDNA, RIKEN full-length
            enriched library, clone:8030401N12 product:CDNA FLJ32798
            FIS, CLONE TESTI2002498, MODERATELY SIMILAR TO DANIO
            RERIO P55-RELATED MAGUK PROTEIN DLG3 (DLG3) MRNA homolog
            [Homo sapiens], full insert sequence
          Length = 1893

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 97   aaggaacaaataaatggccc 116
            ||||||||||||||||||||
Sbjct: 1865 aaggaacaaataaatggccc 1884

>gb|AC079354.4| Homo sapiens BAC clone RP11-1145F21 from 2, complete sequence
          Length = 162554

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    tatgctcaaccatctgttat 68
             ||||||||||||||||||||
Sbjct: 57034 tatgctcaaccatctgttat 57053

>gb|AC164654.3| Gallus gallus BAC clone CH261-5H7 from chromosome unknown, complete
             sequence
          Length = 250515

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 253   tgttctcctcattttttgcaacaatgcc 280
             ||||||||||||| || |||||||||||
Sbjct: 96850 tgttctcctcattcttagcaacaatgcc 96823

>gb|AC160653.3| Pan troglodytes BAC clone CH251-453K4 from chromosome unknown, complete
              sequence
          Length = 178835

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 244    ttcatgtattgttctcctcatttt 267
              ||||||||||||| ||||||||||
Sbjct: 120774 ttcatgtattgttttcctcatttt 120751

>emb|AL732520.14| Mouse DNA sequence from clone RP23-123E1 on chromosome 4, complete
              sequence
          Length = 167166

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 86     caaaggatttcaaggaacaaataa 109
              |||||||||||||| |||||||||
Sbjct: 110449 caaaggatttcaagaaacaaataa 110426

>dbj|AP001829.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-254C5, complete
             sequence
          Length = 117291

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   attttttgcaacaatgccca 282
             ||||||||||||||||||||
Sbjct: 70148 attttttgcaacaatgccca 70167


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,428,621
Number of Sequences: 3902068
Number of extensions: 3428621
Number of successful extensions: 65919
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65875
Number of HSP's gapped (non-prelim): 44
length of query: 359
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 337
effective length of database: 17,147,199,772
effective search space: 5778606323164
effective search space used: 5778606323164
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)