>emb|AL772328.13| Mouse DNA sequence from clone RP23-270A19 on chromosome 4, complete
             sequence
          Length = 219095

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 387   agcaaaatggcactctttttt 407
             |||||||||||||||||||||
Sbjct: 44662 agcaaaatggcactctttttt 44642

>emb|AL929125.1| Mouse DNA sequence from clone RP23-262O4 on chromosome 2, complete
             sequence
          Length = 183595

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 105   aacccaatgcatgatgtcacc 125
             |||||||||||||||||||||
Sbjct: 51370 aacccaatgcatgatgtcacc 51350

>gb|AC154095.1| Homo sapiens chromosome 12 clone fa0961, complete sequence
          Length = 38257

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 213   tctctgtgtgattgctcaaaactt 236
             ||||||||| ||||||||||||||
Sbjct: 16122 tctctgtgttattgctcaaaactt 16099

>ref|NM_017731.4| Homo sapiens oxysterol binding protein-like 7 (OSBPL7), transcript
            variant 2, mRNA
          Length = 3320

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 110  aatgcatgatgtcaccttgttcca 133
            |||||| |||||||||||||||||
Sbjct: 2126 aatgcaggatgtcaccttgttcca 2103

>ref|NM_145798.2| Homo sapiens oxysterol binding protein-like 7 (OSBPL7), transcript
            variant 1, mRNA
          Length = 3674

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 110  aatgcatgatgtcaccttgttcca 133
            |||||| |||||||||||||||||
Sbjct: 2126 aatgcaggatgtcaccttgttcca 2103

>gb|AC108392.17| Mus musculus chromosome 10, clone RP23-121B23, complete sequence
          Length = 207763

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 168   ctaggtacaatgatgcatgaatac 191
             |||||||||||| |||||||||||
Sbjct: 57686 ctaggtacaatgttgcatgaatac 57663

>gb|AC165265.2| Mus musculus BAC clone RP23-15M14 from chromosome 13, complete sequence
          Length = 237830

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aatgatgcatgaatacgcca 195
              ||||||||||||||||||||
Sbjct: 165343 aatgatgcatgaatacgcca 165324

>emb|Z77249.2|HS358H7 Human DNA sequence from clone RP3-358H7 on chromosome X Contains a
             DEAD-box protein pseudogene and the gene for a novel
             E2F-like protein (LOC51270), complete sequence
          Length = 148864

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 163   taacactaggtacaatgatg 182
             ||||||||||||||||||||
Sbjct: 90062 taacactaggtacaatgatg 90081

>gb|BC065482.1| Homo sapiens oxysterol binding protein-like 7, transcript variant 1,
            mRNA (cDNA clone MGC:71150 IMAGE:6081784), complete cds
          Length = 3640

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 110  aatgcatgatgtcaccttgttcca 133
            |||||| |||||||||||||||||
Sbjct: 2098 aatgcaggatgtcaccttgttcca 2075

>gb|AC011611.26| Homo sapiens 12 BAC RP11-290L1 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 179085

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 213    tctctgtgtgattgctcaaaactt 236
              ||||||||| ||||||||||||||
Sbjct: 178613 tctctgtgttattgctcaaaactt 178590

>gb|AF392446.1|AF392446 Homo sapiens oxysterol-binding protein-like protein OSBPL7 (OSBPL7)
            mRNA, complete cds
          Length = 3349

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 110  aatgcatgatgtcaccttgttcca 133
            |||||| |||||||||||||||||
Sbjct: 2179 aatgcaggatgtcaccttgttcca 2156

>gb|AF323729.1|AF323729 Homo sapiens OSBP-related protein 7 mRNA, complete cds
          Length = 2883

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 110  aatgcatgatgtcaccttgttcca 133
            |||||| |||||||||||||||||
Sbjct: 2115 aatgcaggatgtcaccttgttcca 2092

>gb|AC122937.4| Mus musculus BAC clone RP23-24P3 from chromosome 15, complete sequence
          Length = 196863

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tgtctctgtgtgattgctca 230
             ||||||||||||||||||||
Sbjct: 57497 tgtctctgtgtgattgctca 57516

>gb|AC159207.2| Mus musculus BAC clone RP23-150H14 from chromosome 13, complete sequence
          Length = 191824

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    aatgatgcatgaatacgcca 195
              ||||||||||||||||||||
Sbjct: 157021 aatgatgcatgaatacgcca 157040

>gb|AC126033.4| Mus musculus BAC clone RP24-115A22 from chromosome 14, complete
             sequence
          Length = 154626

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   aagaataaaacactgctgtc 214
             ||||||||||||||||||||
Sbjct: 57112 aagaataaaacactgctgtc 57093

>gb|AY730759.1| Bartonella vinsonii subsp. arupensis BrpC (brpC) gene, partial cds;
            BrpB (brpB), BrpA (brpA), hypothetical protein,
            exopolyphosphatase, and FtsJ (ftsJ) genes, complete cds;
            and GTP-binding protein gene, partial cds
          Length = 26422

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 276  aaagaagcaaatagttttgc 295
            ||||||||||||||||||||
Sbjct: 7125 aaagaagcaaatagttttgc 7144

>gb|AC010134.5| Homo sapiens BAC clone RP11-127K18 from 2, complete sequence
          Length = 202943

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 83     ctgataagcttaacacagtc 102
              ||||||||||||||||||||
Sbjct: 159899 ctgataagcttaacacagtc 159918

>gb|AC114290.2| Homo sapiens chromosome 5 clone CTD-3062C19, complete sequence
          Length = 76144

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     gatttgacatactattacaa 21
             ||||||||||||||||||||
Sbjct: 25010 gatttgacatactattacaa 24991

>gb|AC003665.1|AC003665 Homo sapiens chromosome 17, clone hCIT.211_P_7, complete sequence
          Length = 145528

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   aatgcatgatgtcaccttgttcca 133
             |||||| |||||||||||||||||
Sbjct: 46371 aatgcaggatgtcaccttgttcca 46348

>dbj|AB208886.1| Homo sapiens mRNA for oxysterol-binding protein-like protein 7
            variant protein
          Length = 4497

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 110  aatgcatgatgtcaccttgttcca 133
            |||||| |||||||||||||||||
Sbjct: 2973 aatgcaggatgtcaccttgttcca 2950


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,513,054
Number of Sequences: 3902068
Number of extensions: 3513054
Number of successful extensions: 62205
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62169
Number of HSP's gapped (non-prelim): 36
length of query: 419
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 397
effective length of database: 17,147,199,772
effective search space: 6807438309484
effective search space used: 6807438309484
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)