>gb|BC101863.1| Rattus norvegicus similar to a disintegrin-like and metalloprotease
           (reprolysin type) with thrombospondin type 1 motif, 10,
           mRNA (cDNA clone MGC:124747 IMAGE:7939411), complete cds
          Length = 1932

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 719 atctctcactccacaggctgtgtc 696

>gb|AF163762.1| Homo sapiens zinc metalloendopeptidase (ADAMTS10) mRNA, partial cds
          Length = 3400

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 516 atctctcactccacaggctgtgtc 493

>gb|BC062489.1| Xenopus tropicalis kelch domain containing 4, mRNA (cDNA clone
           IMAGE:5379822), partial cds
          Length = 1134

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  atggatctctcactccacac 74
           ||||||||||||||||||||
Sbjct: 273 atggatctctcactccacac 292

>ref|NM_001034930.1| Rattus norvegicus similar to a disintegrin-like and metalloprotease
           (reprolysin type) with thrombospondin type 1 motif, 10
           (LOC314655), mRNA
          Length = 1932

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 719 atctctcactccacaggctgtgtc 696

>ref|XM_590783.2| PREDICTED: Bos taurus similar to ADAM metallopeptidase with
           thrombospondin type 1 motif, 10 preproprotein,
           transcript variant 1 (LOC513140), mRNA
          Length = 3601

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 688 atctctcactccacaggctgtgtc 665

>ref|XM_883027.1| PREDICTED: Bos taurus similar to ADAM metallopeptidase with
           thrombospondin type 1 motif, 10 preproprotein,
           transcript variant 3 (LOC513140), mRNA
          Length = 3655

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 688 atctctcactccacaggctgtgtc 665

>ref|NM_030957.2| Homo sapiens ADAM metallopeptidase with thrombospondin type 1
           motif, 10 (ADAMTS10), mRNA
          Length = 4237

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 868 atctctcactccacaggctgtgtc 845

>gb|BC082773.1| Mus musculus a disintegrin-like and metallopeptidase (reprolysin
           type) with thrombospondin type 1 motif, 10, mRNA (cDNA
           clone IMAGE:6511555), containing frame-shift errors
          Length = 4140

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 748 atctctcactccacaggctgtgtc 725

>gb|BC056427.1| Mus musculus a disintegrin-like and metallopeptidase (reprolysin
           type) with thrombospondin type 1 motif, 10, mRNA (cDNA
           clone IMAGE:5698210), containing frame-shift errors
          Length = 4027

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 726 atctctcactccacaggctgtgtc 703

>ref|XM_993386.1| PREDICTED: Mus musculus a disintegrin-like and metallopeptidase
           (reprolysin type) with thrombospondin type 1 motif, 10
           (Adamts10), mRNA
          Length = 3766

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 736 atctctcactccacaggctgtgtc 713

>ref|XM_905505.1| PREDICTED: Mus musculus a disintegrin-like and metallopeptidase
           (reprolysin type) with thrombospondin type 1 motif, 10
           (Adamts10), mRNA
          Length = 4039

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 736 atctctcactccacaggctgtgtc 713

>ref|XM_989486.1| PREDICTED: Mus musculus a disintegrin-like and metallopeptidase
           (reprolysin type) with thrombospondin type 1 motif, 10
           (Adamts10), mRNA
          Length = 4039

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 736 atctctcactccacaggctgtgtc 713

>gb|BC100558.1| Mus musculus a disintegrin-like and metallopeptidase (reprolysin
           type) with thrombospondin type 1 motif, 10, mRNA (cDNA
           clone IMAGE:5143430), complete cds
          Length = 909

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 510 atctctcactccacaggctgtgtc 487

>ref|NM_172619.2| Mus musculus a disintegrin-like and metallopeptidase (reprolysin
           type) with thrombospondin type 1 motif, 10 (Adamts10),
           mRNA
          Length = 3731

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 728 atctctcactccacaggctgtgtc 705

>dbj|AK042525.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730001E07 product:ADAMTS-10
           PRECURSOR (EC 3.4.24.-) (A DISINTEGRIN AND
           METALLOPROTEINASE WITH THROMBOSPONDIN MOTIFS 10)
           (ADAM-TS 10) (ADAM-TS10) (FRAGMENT) homolog [Homo
           sapiens], full insert sequence
          Length = 3983

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 744 atctctcactccacaggctgtgtc 721

>dbj|AK034565.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430006O18 product:a disintegrin-like and
           metalloprotease (reprolysin type) with thrombospondin
           type 1 motif, 10, full insert sequence
          Length = 1799

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 731 atctctcactccacaggctgtgtc 708

>dbj|AK076334.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched
           library, clone:4732442E24 product:ADAMTS-10 PRECURSOR
           (EC 3.4.24.-) (A DISINTEGRIN AND METALLOPROTEINASE WITH
           THROMBOSPONDIN MOTIFS 10) (ADAM-TS 10) (ADAM-TS10)
           (FRAGMENT) homolog [Homo sapiens], full insert sequence
          Length = 3328

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 730 atctctcactccacaggctgtgtc 707

>emb|AL591401.5| Zebrafish DNA sequence from clone BUSM1-175P12 in linkage group 7,
             complete sequence
          Length = 84068

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 43    ttgcaacaaagcatggatct 62
             ||||||||||||||||||||
Sbjct: 48653 ttgcaacaaagcatggatct 48634

>dbj|AB209515.1| Homo sapiens mRNA for a disintegrin-like and metalloprotease
           (reprolysin type) with thrombospondin type 1 motif, 10
           preproprotein variant protein
          Length = 3423

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  atctctcactccacacgctgtgtc 82
           ||||||||||||||| ||||||||
Sbjct: 731 atctctcactccacaggctgtgtc 708

>ref|NM_127451.1| Arabidopsis thaliana unknown protein AT2G18940 mRNA, complete cds
          Length = 2666

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 34   accacaaacttgcaacaaagcat 56
            |||| ||||||||||||||||||
Sbjct: 1035 accaaaaacttgcaacaaagcat 1013

>gb|AC167561.3| Culex pipiens quinquefasciatus, clone Culex pipiens
              quinquefasciatus-3940117D9, complete sequence
          Length = 143368

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 54     catggatctctcactccacacgc 76
              |||||| ||||||||||||||||
Sbjct: 131716 catggagctctcactccacacgc 131694

>ref|XM_582759.2| PREDICTED: Bos taurus similar to aldehyde dehydrogenase 16 family,
            member A1 (LOC506329), mRNA
          Length = 2942

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 60   tctctcactccacacgctg 78
            |||||||||||||||||||
Sbjct: 1370 tctctcactccacacgctg 1352

>ref|XM_849227.1| PREDICTED: Canis familiaris similar to a disintegrin-like and
           metalloprotease (reprolysin type) with thrombospondin
           type 1 motif, 10 preproprotein, transcript variant 1
           (LOC611267), mRNA
          Length = 3406

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 60  tctctcactccacacgctgtgtc 82
           |||||||||||||| ||||||||
Sbjct: 687 tctctcactccacaggctgtgtc 665

>gb|BT010749.1| Arabidopsis thaliana At2g18940/F19F24.14 gene, complete cds
          Length = 2469

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 34  accacaaacttgcaacaaagcat 56
           |||| ||||||||||||||||||
Sbjct: 981 accaaaaacttgcaacaaagcat 959

>gb|AC161506.4| Mus musculus chromosome 3, clone RP24-210J6, complete sequence
          Length = 175241

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 41     acttgcaacaaagcatgga 59
              |||||||||||||||||||
Sbjct: 146572 acttgcaacaaagcatgga 146554

>emb|AL591382.3| Zebrafish DNA sequence from clone BUSM1-105L16 in linkage group 7
             Contains the nitr2d_1 gene for novel immune-type receptor
             2d, allele 1, the nitr1o_3 gene for novel immune-type
             receptor 1o, allele 3, the nitr1m_2 gene for novel
             immune-type receptor 1m, allele 2, the nitr1l_2 gene for
             novel immune-type receptor 1l, allele 2, a novel
             immune-type receptor 1 pseudogene, the nitr5_4 gene for
             novel immune-type receptor 5, allele 4, the nitr4a_2 gene
             for novel immune-type receptor 4a, allele 2, the nitr1i_2
             gene for novel immune-type receptor 1i, allele 2, the
             nitr1j_1 gene for novel immune-type receptor 1j, allele 1,
             the nitr1g_1 gene for novel immune-type receptor 1g,
             allele 1, a novel immune-type receptor 4b pseudogene, a
             novel gene, the nitr1k_3 gene for novel immune-type
             receptor 1k, allele 3 and a CpG island, complete sequence
          Length = 98934

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 43    ttgcaacaaagcatggatc 61
             |||||||||||||||||||
Sbjct: 72779 ttgcaacaaagcatggatc 72797

>emb|AL591497.2| Zebrafish DNA sequence from clone BUSM1-173M20 in linkage group 7
            Contains the nitr1.14, nitr1.17, nitr1.18, nitr2.4,
            nitr2.6, nitr3r.2, nitr1.13, nitr1.15, nitr1.16, nitr2.5,
            nitr3.4 and nitr3r.1 genes for novel immune-type
            receptors and a nitr pseudogene, complete sequence
          Length = 127998

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 43   ttgcaacaaagcatggatc 61
            |||||||||||||||||||
Sbjct: 3708 ttgcaacaaagcatggatc 3726

>gb|AC154399.5| Mus musculus chromosome 3, clone RP24-295P14, complete sequence
          Length = 165984

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 41    acttgcaacaaagcatgga 59
             |||||||||||||||||||
Sbjct: 37924 acttgcaacaaagcatgga 37906

>gb|AC003673.3| Arabidopsis thaliana chromosome 2 clone F19F24 map CIC06E08, complete
             sequence
          Length = 99359

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 34    accacaaacttgcaacaaagcat 56
             |||| ||||||||||||||||||
Sbjct: 57091 accaaaaacttgcaacaaagcat 57113

>gb|AY056798.1| Arabidopsis thaliana At2g18940/F19F24.14 mRNA, complete cds
          Length = 2666

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 34   accacaaacttgcaacaaagcat 56
            |||| ||||||||||||||||||
Sbjct: 1035 accaaaaacttgcaacaaagcat 1013

>emb|AL591427.2| Zebrafish DNA sequence from clone BUSM1-219H16 in linkage group 7,
             complete sequence
          Length = 126202

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 43    ttgcaacaaagcatggatc 61
             |||||||||||||||||||
Sbjct: 40636 ttgcaacaaagcatggatc 40618

>gb|AC107237.7| Mus musculus chromosome 3, clone RP23-475B9, complete sequence
          Length = 173716

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 41     acttgcaacaaagcatgga 59
              |||||||||||||||||||
Sbjct: 108560 acttgcaacaaagcatgga 108578

>emb|AL132988.4|CNS01DTW Human chromosome 14 DNA sequence BAC R-320M16 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 157962

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 51     aagcatggatctctcactccaca 73
              ||||| |||||||||||||||||
Sbjct: 124228 aagcagggatctctcactccaca 124206


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 475,471
Number of Sequences: 3902068
Number of extensions: 475471
Number of successful extensions: 36393
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36358
Number of HSP's gapped (non-prelim): 35
length of query: 96
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 75
effective length of database: 17,151,101,840
effective search space: 1286332638000
effective search space used: 1286332638000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)