ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart50a12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, c... 70 4e-10
2emb|X84056.1|HVPAF93 H.vulgare paf93 gene 68 2e-09
3gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 38 1.5
4gb|AY796340.1| Homo sapiens calpain 1, (mu/I) large subunit (CAP... 36 5.7
5ref|NM_005186.2| Homo sapiens calpain 1, (mu/I) large subunit (C... 36 5.7
6gb|BC075862.1| Homo sapiens calpain 1, (mu/I) large subunit, mRN... 36 5.7
7gb|BC008751.2| Homo sapiens calpain 1, (mu/I) large subunit, mRN... 36 5.7
8gb|BC017200.2| Homo sapiens calpain 1, (mu/I) large subunit, mRN... 36 5.7
9ref|XM_540866.2| PREDICTED: Canis familiaris similar to Calpain-... 36 5.7
10ref|NM_174259.2| Bos taurus calpain 1, (mu/I) large subunit (CAP... 36 5.7
11emb|AL161728.25| Human DNA sequence from clone RP11-342C23 on ch... 36 5.7
12emb|X04366.1|HSCANPR Human mRNA for calcium activated neutral pr... 36 5.7
13emb|CR925924.1| Pongo pygmaeus mRNA; cDNA DKFZp459I2220 (from cl... 36 5.7
14gb|BT007596.1| Synthetic construct Homo sapiens calpain 1, (mu/I... 36 5.7
15gb|DQ111768.1| Bos taurus x Bos indicus micromolar calcium activ... 36 5.7
16gb|DQ111767.1| Bos taurus x Bos indicus micromolar calcium activ... 36 5.7
17gb|AF252504.2|AF252504S1 Bos taurus micromolar calcium activated... 36 5.7
18dbj|AB169651.1| Macaca fascicularis brain cDNA, clone: QccE-1245... 36 5.7
19gb|AY197555.1| Bos grunniens macromolar calcium-activiated neutr... 36 5.7
20gb|AF284440.1|AF284440 Macaca fascicularis calpain 1 mRNA, compl... 36 5.7
21gb|AY892804.1| Synthetic construct Homo sapiens clone FLH013287.... 36 5.7
22gb|AF221129.1|AF221129 Bos taurus micromolar calcium-dependent n... 36 5.7
23dbj|AP003068.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 36 5.7
24gb|AY550975.1| Homo sapiens cell proliferation-inducing protein ... 36 5.7

>gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, complete cds
          Length = 2254

 Score = 69.9 bits (35), Expect = 4e-10
 Identities = 38/39 (97%)
 Strand = Plus / Minus

                                                   
Query: 8    gatcaatccctccatcttgacccggacttaaacttaaag 46
            ||||||||||||||||||||| |||||||||||||||||
Sbjct: 2246 gatcaatccctccatcttgacacggacttaaacttaaag 2208



to top

>emb|X84056.1|HVPAF93 H.vulgare paf93 gene
          Length = 1154

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 1   caaagacgatcaatccctccatcttgacccggacttaaacttaaag 46
           |||||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 973 caaagacgatcaatccctccatcttgacacggacttagacgtaaag 928



to top

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 5       gacgatcaatccctccatc 23
               |||||||||||||||||||
Sbjct: 5435517 gacgatcaatccctccatc 5435535



to top

>gb|AY796340.1| Homo sapiens calpain 1, (mu/I) large subunit (CAPN1) gene, complete
            cds
          Length = 34135

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 8605 cctccatcttgacccgga 8588



to top

>ref|NM_005186.2| Homo sapiens calpain 1, (mu/I) large subunit (CAPN1), mRNA
          Length = 3007

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1134 cctccatcttgacccgga 1117



to top

>gb|BC075862.1| Homo sapiens calpain 1, (mu/I) large subunit, mRNA (cDNA clone
            MGC:90445 IMAGE:5223130), complete cds
          Length = 3024

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1091 cctccatcttgacccgga 1074



to top

>gb|BC008751.2| Homo sapiens calpain 1, (mu/I) large subunit, mRNA (cDNA clone
            MGC:3082 IMAGE:3347480), complete cds
          Length = 3061

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1124 cctccatcttgacccgga 1107



to top

>gb|BC017200.2| Homo sapiens calpain 1, (mu/I) large subunit, mRNA (cDNA clone
            MGC:3970 IMAGE:3629894), complete cds
          Length = 2912

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1010 cctccatcttgacccgga 993



to top

>ref|XM_540866.2| PREDICTED: Canis familiaris similar to Calpain-1 catalytic subunit
            (Calpain-1 large subunit) (Calcium-activated neutral
            proteinase 1) (CANP 1) (Calpain mu-type) (muCANP)
            (Micromolar-calpain), transcript variant 1 (LOC483745),
            mRNA
          Length = 2905

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1000 cctccatcttgacccgga 983



to top

>ref|NM_174259.2| Bos taurus calpain 1, (mu/I) large subunit (CAPN1), mRNA
          Length = 2948

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1068 cctccatcttgacccgga 1051



to top

>emb|AL161728.25| Human DNA sequence from clone RP11-342C23 on chromosome 9 Contains the
              FBP1 gene for Fructose-1,6-bisphosphatase 1, a novel gene,
              the FBP2 gene for Fructose-1,6-bisphosphatase 2, a  gene
              for a putative novel protein and one CpG island, complete
              sequence
          Length = 170532

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 27     acccggacttaaacttaa 44
              ||||||||||||||||||
Sbjct: 160181 acccggacttaaacttaa 160164



to top

>emb|X04366.1|HSCANPR Human mRNA for calcium activated neutral protease large subunit
            (muCANP, calpain, EC 3.4.22.17)
          Length = 3007

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1134 cctccatcttgacccgga 1117



to top

>emb|CR925924.1| Pongo pygmaeus mRNA; cDNA DKFZp459I2220 (from clone DKFZp459I2220)
          Length = 3195

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1232 cctccatcttgacccgga 1215



to top

>gb|BT007596.1| Synthetic construct Homo sapiens calpain 1, (mu/I) large subunit
           mRNA, partial cds
          Length = 2145

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 16  cctccatcttgacccgga 33
           ||||||||||||||||||
Sbjct: 991 cctccatcttgacccgga 974



to top

>gb|DQ111768.1| Bos taurus x Bos indicus micromolar calcium activated neutral
           protease 1 (CAPN1) gene, exons 8 through 10 and partial
           cds
          Length = 709

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 16  cctccatcttgacccgga 33
           ||||||||||||||||||
Sbjct: 502 cctccatcttgacccgga 485



to top

>gb|DQ111767.1| Bos taurus x Bos indicus micromolar calcium activated neutral
           protease 1 (CAPN1) gene, exons 8 through 10 and partial
           cds
          Length = 709

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 16  cctccatcttgacccgga 33
           ||||||||||||||||||
Sbjct: 502 cctccatcttgacccgga 485



to top

>gb|AF252504.2|AF252504S1 Bos taurus micromolar calcium activated neutral protease 1 (CAPN1)
            gene, exons 1 through 10
          Length = 6400

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 5753 cctccatcttgacccgga 5736



to top

>dbj|AB169651.1| Macaca fascicularis brain cDNA, clone: QccE-12457, similar to human
            calpain 1, (mu/I) large subunit (CAPN1), mRNA, RefSeq:
            NM_005186.2
          Length = 2962

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1078 cctccatcttgacccgga 1061



to top

>gb|AY197555.1| Bos grunniens macromolar calcium-activiated neutral protease 1
          large subunit (CAPN1) mRNA, partial cds
          Length = 224

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 16 cctccatcttgacccgga 33
          ||||||||||||||||||
Sbjct: 98 cctccatcttgacccgga 81



to top

>gb|AF284440.1|AF284440 Macaca fascicularis calpain 1 mRNA, complete cds
          Length = 2196

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1002 cctccatcttgacccgga 985



to top

>gb|AY892804.1| Synthetic construct Homo sapiens clone FLH013287.01L calpain 1
           (CAPN1) mRNA, partial cds
          Length = 2145

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 16  cctccatcttgacccgga 33
           ||||||||||||||||||
Sbjct: 991 cctccatcttgacccgga 974



to top

>gb|AF221129.1|AF221129 Bos taurus micromolar calcium-dependent neutral protease large
            subunit (CAPN1) mRNA, complete cds
          Length = 2948

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 16   cctccatcttgacccgga 33
            ||||||||||||||||||
Sbjct: 1068 cctccatcttgacccgga 1051



to top

>dbj|AP003068.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-399J13, complete
              sequence
          Length = 187934

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 16     cctccatcttgacccgga 33
              ||||||||||||||||||
Sbjct: 148540 cctccatcttgacccgga 148523



to top

>gb|AY550975.1| Homo sapiens cell proliferation-inducing protein 30 mRNA, complete
           cds
          Length = 2152

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 16  cctccatcttgacccgga 33
           ||||||||||||||||||
Sbjct: 996 cctccatcttgacccgga 979


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 260,366
Number of Sequences: 3902068
Number of extensions: 260366
Number of successful extensions: 63823
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63796
Number of HSP's gapped (non-prelim): 27
length of query: 46
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 26
effective length of database: 17,155,003,908
effective search space: 446030101608
effective search space used: 446030101608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top