ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart50a03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_187875.1| Oryza sativa (japonica cultivar-group), Ozsa831... 56 8e-05
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 56 8e-05
3dbj|AP000816.1| Oryza sativa (japonica cultivar-group) genomic D... 56 8e-05
4dbj|AP000492.1| Oryza sativa (japonica cultivar-group) genomic D... 56 8e-05
5dbj|AK108904.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 8e-05
6gb|AC153493.6| Mus musculus 10 BAC RP23-23J2 (Roswell Park Cance... 46 0.081
7gb|AC022368.2|AC022368 Mus musculus strain C57BL6/J clone RP23-1... 44 0.32
8gb|AC102452.7| Mus musculus chromosome 5, clone RP24-272L20, com... 44 0.32
9ref|XM_309746.2| Anopheles gambiae str. PEST ENSANGP00000023256 ... 42 1.3
10gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 40 5.0
11gb|AC073906.6| Trypanosoma brucei chromosome 6 clone RPCI93-3A7,... 40 5.0
12ref|XM_821196.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 ubi... 40 5.0
13emb|CR940306.3| M.truncatula DNA sequence from clone MTH2-10B11 ... 40 5.0
14gb|AF530557.1| Escherichia coli intimin lambda gene, complete cds 40 5.0
15gb|AF530555.1| Escherichia coli intimin alpha 2 gene, complete cds 40 5.0
16gb|AF530554.1| Escherichia coli intimin epsilon 2 gene, complete... 40 5.0
17gb|AC147472.17| Medicago truncatula clone mth2-24n18, complete s... 40 5.0
18emb|Z11541.1|ECEHECEAE E.coli eae gene for EHEC attaching and ef... 40 5.0
19gb|CP000088.1| Thermobifida fusca YX, complete genome 40 5.0
20emb|X60439.1|ECOEHECAE E.coli attaching and effacing gene 40 5.0
21emb|AL929353.1|PFA929353 Plasmodium falciparum strain 3D7, chrom... 40 5.0
22emb|AJ744865.1| Escherichia coli eae gene for intimin alpha-2, s... 40 5.0
23emb|AJ633129.1| Escherichia coli locus of enterocyte effacement,... 40 5.0
24gb|AC153370.13| Mus musculus 10 BAC RP23-281M13 (Roswell Park Ca... 40 5.0
25dbj|AK165148.1| Mus musculus 2 days pregnant adult female ovary ... 40 5.0
26emb|AJ715409.1| Escherichia coli eae gene for intimin lambda, st... 40 5.0
27gb|AC129600.4| Mus musculus BAC clone RP23-361D7 from chromosome... 40 5.0
28gb|AC007680.2| Homo sapiens BAC clone RP11-354L14 from 2, comple... 40 5.0
29gb|AC007238.3| Homo sapiens BAC clone RP11-19M18 from 2, complet... 40 5.0
30emb|AJ416697.1|PFA416697 Plasmodium falciparum cyc-3 gene for pu... 40 5.0
31dbj|AB118863.1| Escherichia coli O124:H40 eae gene for intimin, ... 40 5.0
32dbj|AB118862.1| Escherichia coli O63:H6 eae gene for intimin, pa... 40 5.0
33dbj|AB118861.1| Escherichia coli O55:H7 eae gene for intimin, pa... 40 5.0
34gb|AC149285.5| Mus musculus BAC clone RP23-139J2 from 5, complet... 40 5.0
35gb|AY104432.1| Zea mays PCO120449 mRNA sequence 40 5.0
36gb|AF081185.1|AF081185 Escherichia coli strain ECOR 37 gamma int... 40 5.0
37gb|AF081184.1|AF081184 Escherichia coli enteropathogenic strain ... 40 5.0
38gb|AF081183.1|AF081183 Escherichia coli enterohemorrhagic strain... 40 5.0
39gb|AF081182.1|AF081182 Escherichia coli enterohemorrhagic strain... 40 5.0
40gb|AF071034.1|AF071034 Escherichia coli L0001 (yicJ) gene, parti... 40 5.0
41gb|DQ303099.1| Uncultured organism clone aT14 cd1 nitrite reduct... 40 5.0
42gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 40 5.0
43dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 40 5.0
44gb|AC164172.10| Mus musculus 10 BAC RP23-392K16 (Roswell Park Ca... 40 5.0 
>ref|NM_187875.1| Oryza sativa (japonica cultivar-group), Ozsa8319 predicted mRNA
          Length = 882

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 275 acctggcaagcggccgccgtgatctccggcgc 306
           |||||||||||||||| |||||||||||||||
Sbjct: 830 acctggcaagcggccggcgtgatctccggcgc 799
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                               
Query: 275     acctggcaagcggccgccgtgatctccggcgc 306
               |||||||||||||||| |||||||||||||||
Sbjct: 8386865 acctggcaagcggccggcgtgatctccggcgc 8386896
to top
>dbj|AP000816.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0503G09
          Length = 59843

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                             
Query: 275   acctggcaagcggccgccgtgatctccggcgc 306
             |||||||||||||||| |||||||||||||||
Sbjct: 51491 acctggcaagcggccggcgtgatctccggcgc 51522
to top
>dbj|AP000492.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
            clone:P0705D01
          Length = 147174

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 275  acctggcaagcggccgccgtgatctccggcgc 306
            |||||||||||||||| |||||||||||||||
Sbjct: 1820 acctggcaagcggccggcgtgatctccggcgc 1851
to top
>dbj|AK108904.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-152-F09, full
           insert sequence
          Length = 1186

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 275 acctggcaagcggccgccgtgatctccggcgc 306
           |||||||||||||||| |||||||||||||||
Sbjct: 910 acctggcaagcggccggcgtgatctccggcgc 879
to top
>gb|AC153493.6| Mus musculus 10 BAC RP23-23J2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 220442

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 47    ttacatagtataagcaaataata 69
             |||||||||||||||||||||||
Sbjct: 53291 ttacatagtataagcaaataata 53313
to top
>gb|AC022368.2|AC022368 Mus musculus strain C57BL6/J clone RP23-192D21, complete sequence
          Length = 207757

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 25    gtccttgtacaaacaaattgtt 46
             ||||||||||||||||||||||
Sbjct: 39585 gtccttgtacaaacaaattgtt 39606
to top
>gb|AC102452.7| Mus musculus chromosome 5, clone RP24-272L20, complete sequence
          Length = 183858

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 25    gtccttgtacaaacaaattgtt 46
             ||||||||||||||||||||||
Sbjct: 59238 gtccttgtacaaacaaattgtt 59217
to top
>ref|XM_309746.2| Anopheles gambiae str. PEST ENSANGP00000023256
           (ENSANGG00000021268), partial mRNA
          Length = 1146

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 351 gctgcaggtggtgttgctgga 371
           |||||||||||||||||||||
Sbjct: 792 gctgcaggtggtgttgctgga 812
to top
>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 59     agcaaataataatccaattgctactcca 86
              |||||||| ||||||| |||||||||||
Sbjct: 437807 agcaaatagtaatccatttgctactcca 437780
to top
>gb|AC073906.6| Trypanosoma brucei chromosome 6 clone RPCI93-3A7, complete sequence
          Length = 175357

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 59    agcaaataataatccaattgctactcca 86
             |||||||| ||||||| |||||||||||
Sbjct: 89623 agcaaatagtaatccatttgctactcca 89596
to top
>ref|XM_821196.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 ubiquitin
           carboxyl-terminal hydrolase (Tb927.6.1110) partial mRNA
          Length = 3291

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 59  agcaaataataatccaattgctactcca 86
           |||||||| ||||||| |||||||||||
Sbjct: 800 agcaaatagtaatccatttgctactcca 827
to top
>emb|CR940306.3| M.truncatula DNA sequence from clone MTH2-10B11 on chromosome 3,
             complete sequence
          Length = 90977

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     gataataacatgaatattgt 26
             ||||||||||||||||||||
Sbjct: 32113 gataataacatgaatattgt 32132
to top
>gb|AF530557.1| Escherichia coli intimin lambda gene, complete cds
          Length = 2817

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 400 gctgcaggtggtgttgctgg 419
to top
>gb|AF530555.1| Escherichia coli intimin alpha 2 gene, complete cds
          Length = 2820

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 400 gctgcaggtggtgttgctgg 419
to top
>gb|AF530554.1| Escherichia coli intimin epsilon 2 gene, complete cds
          Length = 2847

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 400 gctgcaggtggtgttgctgg 419
to top
>gb|AC147472.17| Medicago truncatula clone mth2-24n18, complete sequence
          Length = 133272

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 7    gataataacatgaatattgt 26
            ||||||||||||||||||||
Sbjct: 2508 gataataacatgaatattgt 2489
to top
>emb|Z11541.1|ECEHECEAE E.coli eae gene for EHEC attaching and effacing (Eae) protein
          Length = 3106

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 468 gctgcaggtggtgttgctgg 487
to top
>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 318     gatgaggggggtgtggtggg 337
               ||||||||||||||||||||
Sbjct: 1870734 gatgaggggggtgtggtggg 1870753
to top
>emb|X60439.1|ECOEHECAE E.coli attaching and effacing gene
          Length = 3131

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 605 gctgcaggtggtgttgctgg 624
to top
>emb|AL929353.1|PFA929353 Plasmodium falciparum strain 3D7, chromosome 5, segment 3/4
          Length = 343050

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      ataataacatgaatattgtc 27
              ||||||||||||||||||||
Sbjct: 102186 ataataacatgaatattgtc 102167
to top
>emb|AJ744865.1| Escherichia coli eae gene for intimin alpha-2, strain AEEC-IH3979A
          Length = 2820

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 400 gctgcaggtggtgttgctgg 419
to top
>emb|AJ633129.1| Escherichia coli locus of enterocyte effacement, strain 0181-6/86
          Length = 35786

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 351   gctgcaggtggtgttgctgg 370
             ||||||||||||||||||||
Sbjct: 25251 gctgcaggtggtgttgctgg 25270
to top
>gb|AC153370.13| Mus musculus 10 BAC RP23-281M13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 213550

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 318    gatgaggggggtgtggtggg 337
              ||||||||||||||||||||
Sbjct: 179534 gatgaggggggtgtggtggg 179553
to top
>dbj|AK165148.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330040D13
           product:unclassifiable, full insert sequence
          Length = 3436

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  aaacaaattgttttacatag 54
           ||||||||||||||||||||
Sbjct: 639 aaacaaattgttttacatag 620
to top
>emb|AJ715409.1| Escherichia coli eae gene for intimin lambda, strain EPEC-68.4
          Length = 2817

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 400 gctgcaggtggtgttgctgg 419
to top
>gb|AC129600.4| Mus musculus BAC clone RP23-361D7 from chromosome 5, complete sequence
          Length = 223491

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     aaacaaattgttttacatag 54
              ||||||||||||||||||||
Sbjct: 216254 aaacaaattgttttacatag 216273
to top
>gb|AC007680.2| Homo sapiens BAC clone RP11-354L14 from 2, complete sequence
          Length = 146333

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 172  cattgtctctgcactttttc 191
            ||||||||||||||||||||
Sbjct: 3992 cattgtctctgcactttttc 3973
to top
>gb|AC007238.3| Homo sapiens BAC clone RP11-19M18 from 2, complete sequence
          Length = 169147

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      tagcagataataacatgaat 21
              ||||||||||||||||||||
Sbjct: 157043 tagcagataataacatgaat 157062
to top
>emb|AJ416697.1|PFA416697 Plasmodium falciparum cyc-3 gene for putative cyclin 3
          Length = 690

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 8   ataataacatgaatattgtc 27
           ||||||||||||||||||||
Sbjct: 605 ataataacatgaatattgtc 624
to top
>dbj|AB118863.1| Escherichia coli O124:H40 eae gene for intimin, partial cds,
           strain: KI1492
          Length = 434

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 306 gctgcaggtggtgttgctgg 325
to top
>dbj|AB118862.1| Escherichia coli O63:H6 eae gene for intimin, partial cds, strain:
           KI1699
          Length = 434

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 306 gctgcaggtggtgttgctgg 325
to top
>dbj|AB118861.1| Escherichia coli O55:H7 eae gene for intimin, partial cds, strain:
           KI1231
          Length = 434

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 306 gctgcaggtggtgttgctgg 325
to top
>gb|AC149285.5| Mus musculus BAC clone RP23-139J2 from 5, complete sequence
          Length = 201978

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     aaacaaattgttttacatag 54
              ||||||||||||||||||||
Sbjct: 103410 aaacaaattgttttacatag 103429
to top
>gb|AY104432.1| Zea mays PCO120449 mRNA sequence
          Length = 2218

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 344 accggcggctgcaggtggtg 363
           ||||||||||||||||||||
Sbjct: 788 accggcggctgcaggtggtg 807
to top
>gb|AF081185.1|AF081185 Escherichia coli strain ECOR 37 gamma intimin (eae) gene, complete
           cds
          Length = 2805

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 400 gctgcaggtggtgttgctgg 419
to top
>gb|AF081184.1|AF081184 Escherichia coli enteropathogenic strain DEC 5d gamma intimin (eae)
           gene, complete cds
          Length = 2805

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 400 gctgcaggtggtgttgctgg 419
to top
>gb|AF081183.1|AF081183 Escherichia coli enterohemorrhagic strain DEC 3f gamma intimin
           (eae) gene, complete cds
          Length = 2805

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 400 gctgcaggtggtgttgctgg 419
to top
>gb|AF081182.1|AF081182 Escherichia coli enterohemorrhagic strain DEC 3a gamma intimin
           (eae) gene, complete cds
          Length = 2805

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 351 gctgcaggtggtgttgctgg 370
           ||||||||||||||||||||
Sbjct: 400 gctgcaggtggtgttgctgg 419
to top
>gb|AF071034.1|AF071034 Escherichia coli L0001 (yicJ) gene, partial cds; tRNA-Sec gene,
             complete sequence; CP4-like integrase (int), L0004, L0005,
             L0006, L0007, L0008, L0009, L0010, L0011, L0012, L0013,
             L0014, L0015, L0016, L0017, L0018 (escF), L0019, L0020
             (espB), L0021 (espD), L0022 (espA), L0023 (sepL), L0024
             (escD), L0025 (eaeA), L0026 (orfU), L0027 (tir), L0028,
             L0029, L0030, L0031 (sepQ), L0032, L0033, L0034 (escN),
             L0035 (escV), L0036, L0037 (sepZ), L0038, L0039 (escJ),
             L0040, L0041 (escC), L0042 (cesD), L0043, L0044, L0045,
             L0046 (escU), L0047 (escT), L0048 (escS), L0049 (escR),
             L0050, L0051, L0052, L0053, L0054, L0055, and L0056 genes,
             complete cds; and L0057 (yicL) gene, partial cds
          Length = 45325

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 351   gctgcaggtggtgttgctgg 370
             ||||||||||||||||||||
Sbjct: 18887 gctgcaggtggtgttgctgg 18868
to top
>gb|DQ303099.1| Uncultured organism clone aT14 cd1 nitrite reductase (nirS) gene,
           partial cds
          Length = 781

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 229 ggcggactccttgtccttgg 248
           ||||||||||||||||||||
Sbjct: 693 ggcggactccttgtccttgg 674
to top
>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 351     gctgcaggtggtgttgctgg 370
               ||||||||||||||||||||
Sbjct: 4667846 gctgcaggtggtgttgctgg 4667827
to top
>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 351     gctgcaggtggtgttgctgg 370
               ||||||||||||||||||||
Sbjct: 4598863 gctgcaggtggtgttgctgg 4598844
to top
>gb|AC164172.10| Mus musculus 10 BAC RP23-392K16 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 184194

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 318   gatgaggggggtgtggtggg 337
             ||||||||||||||||||||
Sbjct: 99681 gatgaggggggtgtggtggg 99700


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,232,624
Number of Sequences: 3902068
Number of extensions: 3232624
Number of successful extensions: 64133
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63969
Number of HSP's gapped (non-prelim): 164
length of query: 377
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 355
effective length of database: 17,147,199,772
effective search space: 6087255919060
effective search space used: 6087255919060
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top