>ref|XM_472010.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1902

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 386  actatcactcgacctgatctggtccttctcattttgagaga 426
            |||| ||| ||||||||||| || ||||||| |||||||||
Sbjct: 1760 actaccacgcgacctgatctagttcttctcagtttgagaga 1720

>gb|AC008284.7| Drosophila melanogaster clone BACR03M22, complete sequence
          Length = 161996

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 151    atatgcaaatatccagtggta 171
              |||||||||||||||||||||
Sbjct: 119627 atatgcaaatatccagtggta 119607

>gb|AC008367.5| Drosophila melanogaster clone BACR10P10, complete sequence
          Length = 176231

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 151  atatgcaaatatccagtggta 171
            |||||||||||||||||||||
Sbjct: 4405 atatgcaaatatccagtggta 4385

>emb|AL137017.9| Human DNA sequence from clone RP11-120J1 on chromosome 9 Contains the
             3' end of a novel gene and a CpG island, complete sequence
          Length = 167585

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 112   aaaataaaagctgcccatatc 132
             |||||||||||||||||||||
Sbjct: 79870 aaaataaaagctgcccatatc 79850

>emb|BX005271.9| Zebrafish DNA sequence from clone CH211-145F15 in linkage group 5,
             complete sequence
          Length = 162019

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 31    aagggtgagtaagttagttgatatc 55
             ||||||| |||||||||||||||||
Sbjct: 89401 aagggtgggtaagttagttgatatc 89425

>dbj|AK102622.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033099H13, full
            insert sequence
          Length = 2291

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 386  actatcactcgacctgatctggtccttctcattttgagaga 426
            |||| ||| ||||||||||| || ||||||| |||||||||
Sbjct: 1761 actaccacgcgacctgatctagttcttctcagtttgagaga 1721

>gb|AE003751.3| Drosophila melanogaster chromosome 3R, section 89 of 118 of the complete
              sequence
          Length = 307443

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 151    atatgcaaatatccagtggta 171
              |||||||||||||||||||||
Sbjct: 243018 atatgcaaatatccagtggta 243038

>gb|AC148914.1| Pan troglodytes fosmid clone CH1251-3937G7 from Y, complete sequence
          Length = 34934

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 75    acaaaaataatcttgatgacttca 98
             ||||||||||| ||||||||||||
Sbjct: 20145 acaaaaataatattgatgacttca 20168

>gb|AC142296.1| Pan troglodytes BAC clone RP43-97L1 from Y, complete sequence
          Length = 158231

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 75   acaaaaataatcttgatgacttca 98
            ||||||||||| ||||||||||||
Sbjct: 7545 acaaaaataatattgatgacttca 7522

>emb|AL672272.10| Mouse DNA sequence from clone RP23-47N2 on chromosome 4 Contains the Rgs3
              gene for regulator of G-protein signaling 3, three novel
              genes and a CpG island, complete sequence
          Length = 184345

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 166    gtggtagaaacaagtggatc 185
              ||||||||||||||||||||
Sbjct: 160949 gtggtagaaacaagtggatc 160930

>emb|BX001034.6| Human DNA sequence from clone RP11-21H4 on chromosome 9 Contains a
            novel pseudogene and a novel zinc finger pseudogene,
            complete sequence
          Length = 173100

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 69   gattgcacaaaaataatctt 88
            ||||||||||||||||||||
Sbjct: 4174 gattgcacaaaaataatctt 4193

>gb|AF407541.1| Lanthanotus borneensis 16S ribosomal RNA gene, partial sequence;
            tRNA-Leu gene, complete sequence; NADH dehydrogenase
            subunit 1 (ND1) gene, complete cds; tRNA-Ile, tRNA-Gln,
            and tRNA-Met genes, complete sequence; NADH dehydrogenase
            subunit 2 (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala,
            tRNA-Asn, tRNA-Cys, and tRNA-Tyr genes, complete
            sequence; and cytochrome c oxidase subunit I (COI) gene,
            partial cds; mitochondrial genes for mitochondrial
            products
          Length = 2821

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 153  atgcaaatatccagtggtag 172
            ||||||||||||||||||||
Sbjct: 1467 atgcaaatatccagtggtag 1448

>gb|AC125634.1| Homo sapiens 3 BAC RP11-512E23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 162478

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 69     gattgcacaaaaataatctt 88
              ||||||||||||||||||||
Sbjct: 149596 gattgcacaaaaataatctt 149577

>dbj|BS000589.1| Pan troglodytes chromosome Y clone:PTB-234J08, complete sequence
          Length = 179633

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 75     acaaaaataatcttgatgacttca 98
              ||||||||||| ||||||||||||
Sbjct: 124308 acaaaaataatattgatgacttca 124285

>dbj|BS000569.1| Pan troglodytes chromosome Y clone:PTFY-001L05, complete sequences
          Length = 39366

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 75   acaaaaataatcttgatgacttca 98
            ||||||||||| ||||||||||||
Sbjct: 9539 acaaaaataatattgatgacttca 9516

>dbj|BS000665.1| Pan troglodytes chromosome Y clone:PTB-114E01, complete sequences
          Length = 178566

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 75   acaaaaataatcttgatgacttca 98
            ||||||||||| ||||||||||||
Sbjct: 7083 acaaaaataatattgatgacttca 7060

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 75       acaaaaataatcttgatgacttca 98
                ||||||||||| ||||||||||||
Sbjct: 20463590 acaaaaataatattgatgacttca 20463613

>gb|AC114786.4| Homo sapiens BAC clone RP11-618I10 from 4, complete sequence
          Length = 148977

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   cttgccagttagccaagtta 300
             ||||||||||||||||||||
Sbjct: 95635 cttgccagttagccaagtta 95654



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 281   cttgccagttagccaagtta 300
             ||||||||||||||||||||
Sbjct: 70616 cttgccagttagccaagtta 70597

>gb|AC182428.2| Pan troglodytes BAC clone CH251-637G21 from chromosome 4, complete
              sequence
          Length = 210098

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 281    cttgccagttagccaagtta 300
              ||||||||||||||||||||
Sbjct: 108195 cttgccagttagccaagtta 108214

>gb|AC157894.3| Medicago truncatula chromosome 7 BAC clone mth2-85d15, complete
             sequence
          Length = 127331

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 77    aaaaataatcttgatgactt 96
             ||||||||||||||||||||
Sbjct: 26747 aaaaataatcttgatgactt 26766

>gb|AC092188.1|AC092188 Drosophila melanogaster, chromosome 2L, region 22B-22C, BAC clone
             BACR28O09, complete sequence
          Length = 177326

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 283   tgccagttagccaagttagc 302
             ||||||||||||||||||||
Sbjct: 90478 tgccagttagccaagttagc 90459

>gb|AC008546.6|AC008546 Homo sapiens chromosome 5 clone CTC-501K1, complete sequence
          Length = 205954

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 154    tgcaaatatccagtggtagaaacaagtg 181
              |||||| |||||| ||||||||||||||
Sbjct: 139353 tgcaaagatccaggggtagaaacaagtg 139380

>gb|AC022348.2|AC022348 Drosophila melanogaster, chromosome X, region 17E-18A, BAC clone
             BACR32F24, complete sequence
          Length = 162307

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gccagttagccaagttagcc 303
             ||||||||||||||||||||
Sbjct: 54292 gccagttagccaagttagcc 54273

>gb|AC111000.3| Homo sapiens BAC clone RP13-644M16 from 4, complete sequence
          Length = 156578

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 281    cttgccagttagccaagtta 300
              ||||||||||||||||||||
Sbjct: 126575 cttgccagttagccaagtta 126594

>gb|AC151722.2| Pan troglodytes BAC clone CH251-580N2 from chromosome y, complete
             sequence
          Length = 182549

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 75    acaaaaataatcttgatgacttca 98
             ||||||||||| ||||||||||||
Sbjct: 93568 acaaaaataatattgatgacttca 93545

>gb|AC017032.3|AC017032 Homo sapiens BAC clone RP11-292E8 from Y, complete sequence
          Length = 45123

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 75    acaaaaataatcttgatgacttca 98
             ||||||||||| ||||||||||||
Sbjct: 25756 acaaaaataatattgatgacttca 25733

>gb|AE003585.5| Drosophila melanogaster chromosome 2L, section 6 of 83 of the complete
             sequence
          Length = 343161

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 283   tgccagttagccaagttagc 302
             ||||||||||||||||||||
Sbjct: 13607 tgccagttagccaagttagc 13626

>gb|AE003508.4| Drosophila melanogaster chromosome X, section 60 of 74 of the complete
             sequence
          Length = 290619

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gccagttagccaagttagcc 303
             ||||||||||||||||||||
Sbjct: 90886 gccagttagccaagttagcc 90867

>gb|AY662537.1| Lanthanotus borneensis NADH dehydrogenase subunit 1 (ND1) gene,
           partial cds; tRNA-Ile, tRNA-Glu, and tRNA-Met genes,
           complete sequence; NADH dehydrogenase subunit 2 (ND2)
           gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn,
           tRNA-Cys, and tRNA-Tyr genes, complete sequence; and
           cytochrome c oxidase subunit I (COI) gene, partial cds;
           mitochondrial
          Length = 1734

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 153 atgcaaatatccagtggtag 172
           ||||||||||||||||||||
Sbjct: 383 atgcaaatatccagtggtag 364

>gb|AC004441.1|AC004441 Drosophila melanogaster DNA sequence (P1 DS00676 (D67)), complete
             sequence
          Length = 67776

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 283   tgccagttagccaagttagc 302
             ||||||||||||||||||||
Sbjct: 35901 tgccagttagccaagttagc 35882


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,799,423
Number of Sequences: 3902068
Number of extensions: 3799423
Number of successful extensions: 64106
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64024
Number of HSP's gapped (non-prelim): 82
length of query: 430
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 408
effective length of database: 17,147,199,772
effective search space: 6996057506976
effective search space used: 6996057506976
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)