Clone Name | rbart49h01 |
---|---|
Clone Library Name | barley_pub |
>gb|BT009005.1| Triticum aestivum clone wdk2c.pk018.g2:fis, full insert mRNA sequence Length = 1782 Score = 91.7 bits (46), Expect = 1e-15 Identities = 58/62 (93%) Strand = Plus / Minus Query: 251 caccatggcgacgaggctcctccatccggcgccgacggctgcggccgcaccggcgggcgg 310 ||||| |||||||||||||||||| |||||||||||||||||||| || ||||||||||| Sbjct: 818 caccacggcgacgaggctcctccagccggcgccgacggctgcggcggctccggcgggcgg 759 Query: 311 gg 312 || Sbjct: 758 gg 757 Score = 87.7 bits (44), Expect = 2e-14 Identities = 63/69 (91%), Gaps = 4/69 (5%) Strand = Plus / Minus Query: 109 tagtaacctatccaaatccatgcacagcatgcacgcacgcagctagtctccatcgatccg 168 |||||||||||||||||||||||||| ||| |||||||||||||||||||||||| | Sbjct: 949 tagtaacctatccaaatccatgcacaacat----gcacgcagctagtctccatcgatctg 894 Query: 169 tcggtctca 177 ||||||||| Sbjct: 893 tcggtctca 885 Score = 46.1 bits (23), Expect = 0.067 Identities = 23/23 (100%) Strand = Plus / Minus Query: 208 tttcttcttcttacaagaggcac 230 ||||||||||||||||||||||| Sbjct: 861 tttcttcttcttacaagaggcac 839
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 44.1 bits (22), Expect = 0.26 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 acggctgcggccgcaccggcgg 306 |||||||||||||||||||||| Sbjct: 1323213 acggctgcggccgcaccggcgg 1323192
>gb|U51997.1| Caenorhabditis elegans cosmid F19G12, complete sequence Length = 28537 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcttgaattttcttcttctt 219 |||||||||||||||||||| Sbjct: 27527 gcttgaattttcttcttctt 27546
>gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 188458 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 93 agccagcaagaagtagtagt 112 |||||||||||||||||||| Sbjct: 83749 agccagcaagaagtagtagt 83768
>gb|AY524544.1| Streptomyces chrysomallus ectoine biosynthesis gene cluster, complete sequence Length = 3366 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 ggctgcggccgcaccggcgg 306 |||||||||||||||||||| Sbjct: 1436 ggctgcggccgcaccggcgg 1455
>gb|AC006330.5| Homo sapiens BAC clone RP11-229D13 from 7, complete sequence Length = 96299 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 198 cagcttgaattttcttcttc 217 |||||||||||||||||||| Sbjct: 55547 cagcttgaattttcttcttc 55566
>emb|AL132848.1|CEY47H10A Caenorhabditis elegans YAC Y47H10A, complete sequence Length = 31521 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcttgaattttcttcttctt 219 |||||||||||||||||||| Sbjct: 5090 gcttgaattttcttcttctt 5109
>gb|AC122341.3| Mus musculus BAC clone RP23-355F8 from chromosome 15, complete sequence Length = 198612 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 109 tagtaacctatccaaatcca 128 |||||||||||||||||||| Sbjct: 46161 tagtaacctatccaaatcca 46142
>gb|AC160638.6| Mus musculus BAC clone RP23-99K6 from chromosome 15, complete sequence Length = 218870 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 109 tagtaacctatccaaatcca 128 |||||||||||||||||||| Sbjct: 173562 tagtaacctatccaaatcca 173543
>gb|AF543417.1| Zea mays major facilitator superfamily antiporter (mfs2) mRNA, complete cds Length = 1629 Score = 40.1 bits (20), Expect = 4.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 atccatgcacagcatgcacgcacgcagc 151 ||||||||| |||| ||||||||||||| Sbjct: 1404 atccatgcagagcacgcacgcacgcagc 1377
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 283 cgacggctgcggccgcaccg 302 |||||||||||||||||||| Sbjct: 1729844 cgacggctgcggccgcaccg 1729825
>gb|AC113165.1| Homo sapiens chromosome 5 clone RP11-213E1, complete sequence Length = 140640 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 194 ctcccagcttgaattttctt 213 |||||||||||||||||||| Sbjct: 6124 ctcccagcttgaattttctt 6105
>gb|AC104119.2| Homo sapiens chromosome 5 clone RP11-34D23, complete sequence Length = 168108 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 194 ctcccagcttgaattttctt 213 |||||||||||||||||||| Sbjct: 44528 ctcccagcttgaattttctt 44547
>gb|AC006762.2| Caenorhabditis elegans cosmid Y42G9A, complete sequence Length = 30585 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcttgaattttcttcttctt 219 |||||||||||||||||||| Sbjct: 27384 gcttgaattttcttcttctt 27403
>gb|AC006460.4| Homo sapiens BAC clone RP11-284E5 from 2, complete sequence Length = 193015 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 206 attttcttcttcttacaaga 225 |||||||||||||||||||| Sbjct: 73314 attttcttcttcttacaaga 73295
>gb|AC008050.6|AC008050 Homo sapiens chromosome 14 clone RP11-141I24 map 14q24.3, complete sequence Length = 176975 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 205 aattttcttcttcttacaag 224 |||||||||||||||||||| Sbjct: 90430 aattttcttcttcttacaag 90449
>gb|AC011372.7| Homo sapiens chromosome 5 clone CTB-108B20, complete sequence Length = 183330 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 tcctcccagcttgaattttc 211 |||||||||||||||||||| Sbjct: 25831 tcctcccagcttgaattttc 25812
>gb|AC025715.3| Caenorhabditis elegans cosmid Y38F2AR, complete sequence Length = 97157 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 200 gcttgaattttcttcttctt 219 |||||||||||||||||||| Sbjct: 332 gcttgaattttcttcttctt 313
>dbj|AK060649.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-H01, full insert sequence Length = 1377 Score = 40.1 bits (20), Expect = 4.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 284 gacggctgcggccgcaccggcggg 307 |||||||||||||| ||||||||| Sbjct: 997 gacggctgcggccggaccggcggg 974
>gb|AC156387.5| Mus musculus 10 BAC RP24-396H15 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 230270 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 93 agccagcaagaagtagtagt 112 |||||||||||||||||||| Sbjct: 45590 agccagcaagaagtagtagt 45609
>emb|Z82260.1|CEC32H11 Caenorhabditis elegans Cosmid C32H11, complete sequence Length = 31654 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcttgaattttcttcttctt 219 |||||||||||||||||||| Sbjct: 15590 gcttgaattttcttcttctt 15609
>emb|AL833781.5| Mouse DNA sequence from clone RP23-447J12 on chromosome 4, complete sequence Length = 165700 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 gcttgaattttcttcttctt 219 |||||||||||||||||||| Sbjct: 94502 gcttgaattttcttcttctt 94521 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,684,018 Number of Sequences: 3902068 Number of extensions: 2684018 Number of successful extensions: 44860 Number of sequences better than 10.0: 22 Number of HSP's better than 10.0 without gapping: 22 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 44790 Number of HSP's gapped (non-prelim): 69 length of query: 312 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 290 effective length of database: 17,147,199,772 effective search space: 4972687933880 effective search space used: 4972687933880 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)