ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart49d07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_187964.1| Oryza sativa (japonica cultivar-group), Ozsa838... 50 0.007
2ref|NM_187960.1| Oryza sativa (japonica cultivar-group), Ozsa838... 50 0.007
3gb|S59242.1|S59189S4 Drosophila melanogaster calbindin-32 (cbn) ... 50 0.007
4emb|X68566.1|DMCALB32A D.melanogaster mRNA for calbindin-32 50 0.007
5ref|NM_057490.3| Drosophila melanogaster Calbindin 53E CG6702-RA... 50 0.007
6gb|AC099032.1| Drosophila melanogaster, chromosome 2R, region 53... 50 0.007
7gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53... 50 0.007
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
9dbj|AP002817.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
10dbj|AP001366.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
11gb|AE003805.3| Drosophila melanogaster chromosome 2R, section 45... 50 0.007
12gb|AC004335.1|AC004335 Drosophila melanogaster, chromosome 2R, r... 50 0.007
13gb|AC010921.12| Drosophila melanogaster clone BACR15L12, complet... 46 0.10
14gb|AC012160.7| Drosophila melanogaster clone BACR06G02, complete... 46 0.10
15gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 46 0.10
16gb|AC122143.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.10
17gb|AC093713.6| Oryza sativa chromosome 3 BAC OSJNBa0094F01 genom... 46 0.10
18dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
19dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
20gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genom... 46 0.10
21gb|AE003504.4| Drosophila melanogaster chromosome X, section 56 ... 46 0.10
22gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 46 0.10
23ref|NM_191547.1| Oryza sativa (japonica cultivar-group), predic... 44 0.41
24ref|XM_477136.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.41
25ref|XM_715612.1| Candida albicans SC5314 putative mitochondrial ... 44 0.41
26ref|XM_715484.1| Candida albicans SC5314 putative mitochondrial ... 44 0.41
27gb|AY557668.1| Saccharomyces cerevisiae clone FLH001548.01X YDR0... 44 0.41
28ref|XM_751605.1| Ustilago maydis 521 hypothetical protein (UM005... 44 0.41
29ref|XM_754916.1| Ustilago maydis 521 hypothetical protein (UM038... 44 0.41
30ref|XM_756814.1| Ustilago maydis 521 hypothetical protein (UM057... 44 0.41
31ref|XM_756822.1| Ustilago maydis 521 hypothetical protein (UM057... 44 0.41
32gb|AC133172.4| Mus musculus BAC clone RP24-273H5 from chromosome... 44 0.41
33ref|XM_735817.1| Plasmodium chabaudi chabaudi hypothetical prote... 44 0.41
34gb|AC138010.13| Medicago truncatula clone mth2-21i21, complete s... 44 0.41
35gb|AC147013.4| Medicago truncatula clone mth2-159f24, complete s... 44 0.41
36gb|DQ450274.1| Drosophila melanogaster isolate tu1402102310 lim ... 44 0.41
37gb|DQ450273.1| Drosophila melanogaster isolate bl3886 lim kinase... 44 0.41
38gb|DQ450271.1| Drosophila melanogaster isolate bl3870 lim kinase... 44 0.41
39gb|DQ450270.1| Drosophila melanogaster isolate bl3864 lim kinase... 44 0.41
40gb|DQ450267.1| Drosophila melanogaster isolate bl3846 lim kinase... 44 0.41
41gb|DQ450266.1| Drosophila melanogaster isolate bl3844 lim kinase... 44 0.41
42gb|DQ450265.1| Drosophila melanogaster isolate bl3841 lim kinase... 44 0.41
43emb|Z46796.1|SC8554 S.cerevisiae chromosome IV cosmid 8554 44 0.41
44emb|X82086.1|SCCHROIV S.cerevisiae DNA for right arm of chromoso... 44 0.41
45emb|AL121806.2|DMBR42I17 Drosophila melanogaster BAC clone BACR4... 44 0.41
46ref|NM_143606.1| Drosophila melanogaster CG15566-RA (CG15566), mRNA 44 0.41
47gb|AC067942.6| Homo sapiens BAC clone RP11-791G16 from 4, comple... 44 0.41
48gb|AC104410.3| Drosophila melanogaster X BAC RP98-10H22 (Roswell... 44 0.41
49emb|BX663616.13| Zebrafish DNA sequence from clone DKEY-287H22 i... 44 0.41
50gb|AC095015.1| Drosophila melanogaster, chromosome 3R, region 84... 44 0.41
51gb|DQ204736.1| Oryza sativa (japonica cultivar-group) cultivar J... 44 0.41
52gb|DQ204735.1| Oryza sativa (japonica cultivar-group) cultivar H... 44 0.41
53gb|AE001572.2| Drosophila melanogaster Antennapedia complex (ANT... 44 0.41
54dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
55dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
56gb|AC009356.3|AC009356 Drosophila melanogaster, chromosome 2R, r... 44 0.41
57gb|AC106743.4| Homo sapiens chromosome 16 clone RP11-116D9, comp... 44 0.41
58gb|AC008287.4|AC008287 Drosophila melanogaster, chromosome 3R, r... 44 0.41
59gb|AC008230.4|AC008230 Drosophila melanogaster, chromosome 2R, r... 44 0.41
60dbj|AP003309.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
61dbj|AP003560.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
62gb|AC018716.4|AC018716 Homo sapiens BAC clone RP11-430H10 from 1... 44 0.41
63gb|AF272705.1|F4I4 Arabidopsis thaliana BAC F4I4 44 0.41
64dbj|AP004334.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
65dbj|AP003633.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
66dbj|AP003628.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
67dbj|AP005098.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
68dbj|AP005779.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
69dbj|AP003738.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
70gb|AF049236.1|AF049236 Arabidopsis thaliana putative transmembra... 44 0.41
71gb|AC157472.3| Medicago truncatula chromosome 7 BAC clone mth2-4... 44 0.41
72dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
73emb|Z74369.1|SCYDR073W S.cerevisiae chromosome IV reading frame ... 44 0.41
74gb|AC001653.1|AC001653 Drosophila melanogaster, chromosome 3R, r... 44 0.41
75gb|AE003673.3| Drosophila melanogaster chromosome 3R, section 11... 44 0.41
76gb|AE003807.3| Drosophila melanogaster chromosome 2R, section 43... 44 0.41
77gb|AE003778.3| Drosophila melanogaster chromosome 3R, section 11... 44 0.41
78gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 o... 44 0.41
79gb|AC004318.1|AC004318 Drosophila melanogaster DNA sequence (P1 ... 44 0.41
80dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 44 0.41
81dbj|AP004579.1| Lotus japonicus genomic DNA, chromosome 2, clone... 44 0.41
82dbj|AP004578.1| Lotus japonicus genomic DNA, chromosome 2, clone... 44 0.41
83gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome 42 1.6
84ref|XM_635042.1| Dictyostelium discoideum hypothetical protein (... 42 1.6
85gb|AC164176.12| Mus musculus 10 BAC RP23-8O18 (Roswell Park Canc... 42 1.6
86gb|AY392542.1| Porcine teschovirus isolate 2-AK-III polyprotein ... 42 1.6
87gb|AY392541.1| Porcine teschovirus isolate 12-PL polyprotein gen... 42 1.6
88gb|AC168279.3| Mus musculus 10 BAC RP23-345H24 (Roswell Park Can... 42 1.6
89gb|AC151537.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.6
90gb|AC151407.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.6
91emb|CR715518.2|CNS0GF1M Tetraodon nigroviridis full-length cDNA 42 1.6
92gb|AC090711.3| Homo sapiens chromosome 8 clone RP11-89H1 map 8q2... 42 1.6
93emb|AL451005.9| Human DNA sequence from clone RP11-92B10 on chro... 42 1.6
94gb|DQ450278.1| Drosophila melanogaster isolate tu1402102317 lim ... 42 1.6
95gb|DQ450277.1| Drosophila melanogaster isolate tu1402102316 lim ... 42 1.6
96gb|DQ450276.1| Drosophila melanogaster isolate tu1402102314 lim ... 42 1.6
97gb|DQ450275.1| Drosophila melanogaster isolate tu1402102311 lim ... 42 1.6
98gb|DQ450272.1| Drosophila melanogaster isolate bl3875 lim kinase... 42 1.6
99gb|DQ450269.1| Drosophila melanogaster isolate bl3853 lim kinase... 42 1.6
100gb|DQ450268.1| Drosophila melanogaster isolate bl3852 lim kinase... 42 1.6
101gb|DQ450264.1| Drosophila melanogaster isolate bl3839 lim kinase... 42 1.6
102gb|DQ450263.1| Drosophila melanogaster isolate bl1 lim kinase (L... 42 1.6
103gb|AC023748.4| Drosophila melanogaster X BAC RP98-36F8 (Roswell ... 42 1.6
104gb|AC023718.4| Drosophila melanogaster X BAC RP98-7P15 (Roswell ... 42 1.6
105tpg|BK003634.1| TPA: TPA_inf: Drosophila melanogaster HDC04273 (... 42 1.6
106gb|AC087110.3| Homo sapiens chromosome 8, clone CTD-2033B22, com... 42 1.6
107gb|AC092190.1|AC092190 Drosophila melanogaster, chromosome X, re... 42 1.6
108gb|AC021325.5|AC021325 Homo sapiens chromosome , clone RP11-23N1... 42 1.6
109gb|AC007144.13|AC007144 Drosophila melanogaster, chromosome 2L, ... 42 1.6
110dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
111dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
112gb|AC008304.3|AC008304 Drosophila melanogaster, chromosome 2R, r... 42 1.6
113gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome 42 1.6
114gb|AC023724.5| Drosophila melanogaster X BAC RP98-14B2 (Roswell ... 42 1.6
115dbj|AP005524.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
116gb|AF246419.1|AF246419 Acidithiobacillus ferroxidans aspartate a... 42 1.6
117emb|BX005447.8| Zebrafish DNA sequence from clone DKEY-29B14, co... 42 1.6
118dbj|AP005394.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
119dbj|AP005756.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
120dbj|AP005544.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
121dbj|AK100833.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
122emb|AL391749.4|CNS06C8I Human chromosome 14 DNA sequence BAC R-2... 42 1.6
123dbj|AP003824.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
124gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77... 42 1.6
125gb|AE003573.4| Drosophila melanogaster chromosome X, section 74 ... 42 1.6
126gb|AE003486.2| Drosophila melanogaster chromosome X, section 38 ... 42 1.6
127gb|AE003460.2| Drosophila melanogaster chromosome 2R, section 68... 42 1.6
128gb|AE003445.2| Drosophila melanogaster chromosome X, section 29 ... 42 1.6
129dbj|AB085897.1| Cucumis sativus CS-PIN1 mRNA for PIN1-like auxin... 42 1.6
130gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome 40 6.3
131ref|XM_629023.1| Dictyostelium discoideum hypothetical protein (... 40 6.3
132ref|NM_032037.2| Homo sapiens testis-specific serine kinase 6 (T... 40 6.3
133gb|AC005965.1| Arabidopsis thaliana BAC T19G15, from chromosome ... 40 6.3
134gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
135gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 6.3
136gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence 40 6.3
137gb|AC120539.4| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
138gb|AC104642.11| Trypanosoma brucei chromosome 3 clone RPCI93-27C... 40 6.3
139gb|AC016158.4| Drosophila melanogaster clone BACR38H07, complete... 40 6.3
140gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete... 40 6.3
141ref|XM_709592.1| Candida albicans SC5314 hypothetical protein (C... 40 6.3
142gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 40 6.3
143gb|AY264885.1|AY227363S2 Zea mays MADS-box transcription factor ... 40 6.3
144ref|XM_751533.1| Ustilago maydis 521 hypothetical protein (UM004... 40 6.3
145emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 6.3
146ref|XM_820523.1| Trypanosoma brucei TREU927 clone RPCI93-27C5 hy... 40 6.3
147ref|XM_750891.1| Aspergillus fumigatus Af293 ubiquitin conjugati... 40 6.3
148gb|AE014311.1| Homo sapiens chromosome 13q34 schizophrenia regio... 40 6.3
149gb|AC146133.3| Pan troglodytes BAC clone RP43-38C10 from 7, comp... 40 6.3
150ref|XM_723534.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 6.3
151ref|XM_960987.1| Plasmodium falciparum 3D7 hypothetical protein ... 40 6.3
152gb|U41992.1| Caenorhabditis elegans cosmid F32E10, complete sequ... 40 6.3
153gb|AE014075.1| Escherichia coli CFT073, complete genome 40 6.3
154emb|CR759789.8| Zebrafish DNA sequence from clone CH211-153M1, c... 40 6.3
155gb|CP000243.1| Escherichia coli UTI89, complete genome 40 6.3
156emb|AL606823.4| Human DNA sequence from clone RP11-49K6 on chrom... 40 6.3
157emb|AL356967.23| Human DNA sequence from clone RP11-427E4 on chr... 40 6.3
158gb|AC124926.7| Rattus norvegicus X BAC CH230-155H3 (Children's H... 40 6.3
159gb|AC093489.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
160emb|Z98547.2|PFMAL3P3 Plasmodium falciparum MAL3P3, complete seq... 40 6.3
161emb|CR382399.1| Plasmodium falciparum chromosome 6, complete seq... 40 6.3
162gb|BC014611.2| Homo sapiens testis-specific serine kinase 6, mRN... 40 6.3
163emb|AL161511.2|ATCHRIV23 Arabidopsis thaliana DNA chromosome 4, ... 40 6.3
164emb|BX927166.14| Zebrafish DNA sequence from clone DKEY-28M24 in... 40 6.3
165gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 6.3
166gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell... 40 6.3
167gb|AC011448.5| Homo sapiens chromosome 19 clone CTC-260F20, comp... 40 6.3
168gb|AC113619.5| Drosophila melanogaster X BAC RP98-22D21 (Roswell... 40 6.3
169gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell ... 40 6.3
170gb|AC010031.8| Drosophila melanogaster 3L BAC RP98-2M20 (Roswell... 40 6.3
171gb|AC149226.11| Danio rerio clone ch211-252j18, complete sequence 40 6.3
172gb|AC023710.5| Drosophila melanogaster X BAC RP98-19D3 (Roswell ... 40 6.3
173tpg|BK002861.1| TPA: TPA_inf: Drosophila melanogaster HDC15820 (... 40 6.3
174gb|AE012068.1| Xanthomonas axonopodis pv. citri str. 306, secti... 40 6.3
175gb|AC007167.5| Arabidopsis thaliana chromosome 2 clone F3C11 map... 40 6.3
176gb|AC006446.4| Arabidopsis thaliana chromosome 2 clone F15O11 ma... 40 6.3
177gb|AC027251.6| Homo sapiens chromosome 8, clone RP11-14G5, compl... 40 6.3
178gb|DP000033.1| Carollia perspicillata target 116 genomic scaffold 40 6.3
179gb|AC155282.1| Medicago truncatula chromosome 2 BAC clone mth2-6... 40 6.3
180gb|AC159628.2| Mus musculus BAC clone RP24-206C4 from chromosome... 40 6.3
181gb|AF348077.1|AF348077 Homo sapiens serine/threonine kinase FKSG... 40 6.3
182gb|AY335719.1| Synthetic construct Homo sapiens serine/threonine... 40 6.3
183dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
184gb|AC009981.6|AC009981 Drosophila melanogaster, chromosome 3R, r... 40 6.3
185gb|AC008358.4|AC008358 Drosophila melanogaster, chromosome 3R, r... 40 6.3
186gb|AC007710.11|AC007710 Drosophila melanogaster, chromosome 3R, ... 40 6.3
187gb|AF329483.1| Homo sapiens serine/threonine protein kinase SSTK... 40 6.3
188gb|AC013437.8| Homo sapiens BAC clone RP11-190J23 from 2, comple... 40 6.3
189dbj|AP004048.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
190dbj|AK172841.1| Homo sapiens cDNA FLJ24002 fis, clone KAIA4350, ... 40 6.3
191dbj|AB028618.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 6.3
192dbj|AB005248.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 6.3
193emb|AL110116.1|ATC18G5 Arabidopsis thaliana DNA chromosome 4, BA... 40 6.3
194dbj|AK058166.1| Homo sapiens cDNA FLJ25437 fis, clone TST08312 40 6.3
195dbj|AK069089.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
196gb|AF077407.1|F9D12 Arabidopsis thaliana BAC F9D12 40 6.3
197emb|AL445363.7|CNS07ECY Human chromosome 14 DNA sequence BAC R-6... 40 6.3
198emb|AL132951.3|CEY67H2A Caenorhabditis elegans YAC Y67H2A, compl... 40 6.3
199emb|BX957286.14| Zebrafish DNA sequence from clone CH211-119B12 ... 40 6.3
200gb|AY110277.1| Zea mays CL615_-1 mRNA sequence 40 6.3
201gb|AE003758.4| Drosophila melanogaster chromosome 3R, section 96... 40 6.3
202gb|AE003730.3| Drosophila melanogaster chromosome 3R, section 68... 40 6.3
203gb|AE003691.4| Drosophila melanogaster chromosome 3R, section 29... 40 6.3
204gb|AE003705.3| Drosophila melanogaster chromosome 3R, section 43... 40 6.3
205gb|AE003536.4| Drosophila melanogaster chromosome 3L, section 49... 40 6.3
206gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 ... 40 6.3
207gb|AE003436.3| Drosophila melanogaster chromosome X, section 20 ... 40 6.3
208gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o... 40 6.3
209emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 40 6.3
210emb|CR536612.8| Zebrafish DNA sequence from clone DKEY-1O1 in li... 40 6.3
211gb|CP000034.1| Shigella dysenteriae Sd197, complete genome 40 6.3
212gb|AC115031.11| Mus musculus chromosome 3, clone RP24-257J5, com... 40 6.3
213emb|AL009146.1|DMC17A9 Drosophila melanogaster cosmid 17A9 40 6.3
214dbj|AB071804.1| Oryza sativa (japonica cultivar-group) mRNA for ... 40 6.3

>ref|NM_187964.1| Oryza sativa (japonica cultivar-group), Ozsa8384 predicted mRNA
          Length = 1383

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 379  ggcatcgccagcgcggcgtggccgaagccgaagtcggtgtc 419
            |||| ||||| |||||||||||||  |||||||||||||||
Sbjct: 1145 ggcagcgccatcgcggcgtggccgtggccgaagtcggtgtc 1105



to top

>ref|NM_187960.1| Oryza sativa (japonica cultivar-group), Ozsa8380 predicted mRNA
          Length = 1383

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 379  ggcatcgccagcgcggcgtggccgaagccgaagtcggtgtc 419
            |||| ||||| |||||||||||||  |||||||||||||||
Sbjct: 1145 ggcagcgccatcgcggcgtggccgtggccgaagtcggtgtc 1105



to top

>gb|S59242.1|S59189S4 Drosophila melanogaster calbindin-32 (cbn) gene, complete cds
          Length = 2162

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 114  ggatgcatttgcatttgcatttgca 138
            |||||||||||||||||||||||||
Sbjct: 1422 ggatgcatttgcatttgcatttgca 1398



to top

>emb|X68566.1|DMCALB32A D.melanogaster mRNA for calbindin-32
          Length = 2648

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 114  ggatgcatttgcatttgcatttgca 138
            |||||||||||||||||||||||||
Sbjct: 1909 ggatgcatttgcatttgcatttgca 1885



to top

>ref|NM_057490.3| Drosophila melanogaster Calbindin 53E CG6702-RA (Cbp53E), mRNA
          Length = 2676

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 114  ggatgcatttgcatttgcatttgca 138
            |||||||||||||||||||||||||
Sbjct: 1928 ggatgcatttgcatttgcatttgca 1904



to top

>gb|AC099032.1| Drosophila melanogaster, chromosome 2R, region 53F-54A, BAC clone
            BACR32P08, complete sequence
          Length = 163072

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 114  ggatgcatttgcatttgcatttgca 138
            |||||||||||||||||||||||||
Sbjct: 2806 ggatgcatttgcatttgcatttgca 2782



to top

>gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53F-54X, BAC clone
              BACR09M08, complete sequence
          Length = 179283

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 114    ggatgcatttgcatttgcatttgca 138
              |||||||||||||||||||||||||
Sbjct: 144489 ggatgcatttgcatttgcatttgca 144465



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                        
Query: 379     ggcatcgccagcgcggcgtggccgaagccgaagtcggtgtc 419
               |||| ||||| |||||||||||||  |||||||||||||||
Sbjct: 8835764 ggcagcgccatcgcggcgtggccgtggccgaagtcggtgtc 8835724



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                        
Query: 379     ggcatcgccagcgcggcgtggccgaagccgaagtcggtgtc 419
               |||| ||||| |||||||||||||  |||||||||||||||
Sbjct: 8816128 ggcagcgccatcgcggcgtggccgtggccgaagtcggtgtc 8816168



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 117      tgcatttgcatttgcatttgca 138
                ||||||||||||||||||||||
Sbjct: 30562652 tgcatttgcatttgcatttgca 30562673



to top

>dbj|AP002817.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0699D11
          Length = 140825

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                       
Query: 379    ggcatcgccagcgcggcgtggccgaagccgaagtcggtgtc 419
              |||| ||||| |||||||||||||  |||||||||||||||
Sbjct: 133585 ggcagcgccatcgcggcgtggccgtggccgaagtcggtgtc 133625



to top

>dbj|AP001366.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0469E09
          Length = 146081

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 379   ggcatcgccagcgcggcgtggccgaagccgaagtcggtgtc 419
             |||| ||||| |||||||||||||  |||||||||||||||
Sbjct: 71792 ggcagcgccatcgcggcgtggccgtggccgaagtcggtgtc 71752



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 379   ggcatcgccagcgcggcgtggccgaagccgaagtcggtgtc 419
             |||| ||||| |||||||||||||  |||||||||||||||
Sbjct: 52156 ggcagcgccatcgcggcgtggccgtggccgaagtcggtgtc 52196



to top

>gb|AE003805.3| Drosophila melanogaster chromosome 2R, section 45 of 73 of the complete
              sequence
          Length = 272948

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 114    ggatgcatttgcatttgcatttgca 138
              |||||||||||||||||||||||||
Sbjct: 262986 ggatgcatttgcatttgcatttgca 262962



to top

>gb|AC004335.1|AC004335 Drosophila melanogaster, chromosome 2R, region 53E1-53F1, P1 clone
             DS03108, complete sequence
          Length = 78592

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 114   ggatgcatttgcatttgcatttgca 138
             |||||||||||||||||||||||||
Sbjct: 39122 ggatgcatttgcatttgcatttgca 39146



to top

>gb|AC010921.12| Drosophila melanogaster clone BACR15L12, complete sequence
          Length = 163466

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 117   tgcatttgcatttgcatttgcag 139
             |||||||||||||||||||||||
Sbjct: 57999 tgcatttgcatttgcatttgcag 57977



to top

>gb|AC012160.7| Drosophila melanogaster clone BACR06G02, complete sequence
          Length = 172069

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 117   tgcatttgcatttgcatttgcag 139
             |||||||||||||||||||||||
Sbjct: 45707 tgcatttgcatttgcatttgcag 45729



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 117      tgcatttgcatttgcatttgcag 139
                |||||||||||||||||||||||
Sbjct: 32984624 tgcatttgcatttgcatttgcag 32984602



to top

>gb|AC122143.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0090F16, complete sequence
          Length = 147341

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                         
Query: 214   aggtactccgcggtgagaggcttgaaaacacgctgctggtctgactctagcgcggccgcg 273
             |||||| |||| |||||||||||||| |  || || | ||| ||||| ||||| ||||| 
Sbjct: 94224 aggtacgccgccgtgagaggcttgaagatgcggtggtcgtcggactccagcgccgccgcc 94165

                                    
Query: 274   aggcgaggccatatgaaggcgct 296
             || || ||||||||| |||||||
Sbjct: 94164 agccgcggccatatgtaggcgct 94142



to top

>gb|AC093713.6| Oryza sativa chromosome 3 BAC OSJNBa0094F01 genomic sequence,
            complete sequence
          Length = 151479

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 117  tgcatttgcatttgcatttgcag 139
            |||||||||||||||||||||||
Sbjct: 5551 tgcatttgcatttgcatttgcag 5573



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                            
Query: 214      aggtactccgcggtgagaggcttgaaaacacgctgctggtctgactctagcgcggccgcg 273
                |||||| |||| |||||||||||||| |  || || | ||| ||||| ||||| ||||| 
Sbjct: 24728264 aggtacgccgccgtgagaggcttgaagatgcggtggtcgtcggactccagcgccgccgcc 24728323

                                       
Query: 274      aggcgaggccatatgaaggcgct 296
                || || ||||||||| |||||||
Sbjct: 24728324 agccgcggccatatgtaggcgct 24728346



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 119     catttgcatttgcatttgca 138
               ||||||||||||||||||||
Sbjct: 3739473 catttgcatttgcatttgca 3739492



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 117      tgcatttgcatttgcatttgcag 139
                |||||||||||||||||||||||
Sbjct: 33075134 tgcatttgcatttgcatttgcag 33075112



to top

>gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence, complete
              sequence
          Length = 139823

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 117    tgcatttgcatttgcatttgcag 139
              |||||||||||||||||||||||
Sbjct: 138684 tgcatttgcatttgcatttgcag 138706



to top

>gb|AE003504.4| Drosophila melanogaster chromosome X, section 56 of 74 of the complete
              sequence
          Length = 298703

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 117    tgcatttgcatttgcatttgcag 139
              |||||||||||||||||||||||
Sbjct: 175924 tgcatttgcatttgcatttgcag 175946



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                            
Query: 214      aggtactccgcggtgagaggcttgaaaacacgctgctggtctgactctagcgcggccgcg 273
                |||||| |||| |||||||||||||| |  || || | ||| ||||| ||||| ||||| 
Sbjct: 25039934 aggtacgccgccgtgagaggcttgaagatgcggtggtcgtcggactccagcgccgccgcc 25039993

                                       
Query: 274      aggcgaggccatatgaaggcgct 296
                || || ||||||||| |||||||
Sbjct: 25039994 agccgcggccatatgtaggcgct 25040016



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 119     catttgcatttgcatttgca 138
               ||||||||||||||||||||
Sbjct: 3748167 catttgcatttgcatttgca 3748186



to top

>ref|NM_191547.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 636

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 228 tgcatttgcatttgcatttgca 249



to top

>ref|XM_477136.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1893

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 1886 tgcatttgcatttgcatttgca 1865



to top

>ref|XM_715612.1| Candida albicans SC5314 putative mitochondrial chaperonin
            (CaO19_11745), mRNA
          Length = 1755

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 1353 tgcatttgcatttgcatttgca 1332



to top

>ref|XM_715484.1| Candida albicans SC5314 putative mitochondrial chaperonin
            (CaO19_4269), mRNA
          Length = 1755

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 1353 tgcatttgcatttgcatttgca 1332



to top

>gb|AY557668.1| Saccharomyces cerevisiae clone FLH001548.01X YDR073W gene, complete
           cds
          Length = 510

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 111 tgcatttgcatttgcatttgca 90



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tgcatttgcatttgcatttg 136
           ||||||||||||||||||||
Sbjct: 105 tgcatttgcatttgcatttg 86



to top

>ref|XM_751605.1| Ustilago maydis 521 hypothetical protein (UM00551.1) partial mRNA
          Length = 2763

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 2252 tgcatttgcatttgcatttgca 2231



to top

>ref|XM_754916.1| Ustilago maydis 521 hypothetical protein (UM03862.1) partial mRNA
          Length = 2751

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 2712 tgcatttgcatttgcatttgca 2691



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 2706 tgcatttgcatttgcatttgca 2685



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 2700 tgcatttgcatttgcatttgca 2679



to top

>ref|XM_756814.1| Ustilago maydis 521 hypothetical protein (UM05760.1) partial mRNA
          Length = 4302

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 118  gcatttgcatttgcatttgcag 139
            ||||||||||||||||||||||
Sbjct: 1543 gcatttgcatttgcatttgcag 1564



to top

>ref|XM_756822.1| Ustilago maydis 521 hypothetical protein (UM05768.1) partial mRNA
          Length = 3120

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 597 tgcatttgcatttgcatttgca 576



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 591 tgcatttgcatttgcatttgca 570



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 602 gcatttgcatttgcatttgca 582



to top

>gb|AC133172.4| Mus musculus BAC clone RP24-273H5 from chromosome 18, complete sequence
          Length = 206797

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 37617 tgcatttgcatttgcatttgca 37596



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 37611 tgcatttgcatttgcatttgca 37590



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 37605 tgcatttgcatttgcatttg 37586



to top

>ref|XM_735817.1| Plasmodium chabaudi chabaudi hypothetical protein (PC104221.00.0)
           partial mRNA
          Length = 180

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 123 tgcatttgcatttgcatttgca 144



to top

>gb|AC138010.13| Medicago truncatula clone mth2-21i21, complete sequence
          Length = 109275

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 66081 tgcatttgcatttgcatttgca 66060



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 66075 tgcatttgcatttgcatttg 66056



to top

>gb|AC147013.4| Medicago truncatula clone mth2-159f24, complete sequence
          Length = 118017

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 74589 tgcatttgcatttgcatttgca 74568



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 74583 tgcatttgcatttgcatttg 74564



to top

>gb|DQ450274.1| Drosophila melanogaster isolate tu1402102310 lim kinase (Lim1)
           gene, intron 1
          Length = 953

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 753 tgcatttgcatttgcatttgca 774



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 759 tgcatttgcatttgcatttgc 779



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 748 gcatttgcatttgcatttgca 768



to top

>gb|DQ450273.1| Drosophila melanogaster isolate bl3886 lim kinase (Lim1) gene,
           intron 1
          Length = 952

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 752 tgcatttgcatttgcatttgca 773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 758 tgcatttgcatttgcatttgc 778



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 747 gcatttgcatttgcatttgca 767



to top

>gb|DQ450271.1| Drosophila melanogaster isolate bl3870 lim kinase (Lim1) gene,
           intron 1
          Length = 959

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 759 tgcatttgcatttgcatttgca 780



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 765 tgcatttgcatttgcatttgc 785



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 754 gcatttgcatttgcatttgca 774



to top

>gb|DQ450270.1| Drosophila melanogaster isolate bl3864 lim kinase (Lim1) gene,
           intron 1
          Length = 954

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 754 tgcatttgcatttgcatttgca 775



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 760 tgcatttgcatttgcatttgc 780



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 749 gcatttgcatttgcatttgca 769



to top

>gb|DQ450267.1| Drosophila melanogaster isolate bl3846 lim kinase (Lim1) gene,
           intron 1
          Length = 953

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 753 tgcatttgcatttgcatttgca 774



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 759 tgcatttgcatttgcatttgc 779



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 748 gcatttgcatttgcatttgca 768



to top

>gb|DQ450266.1| Drosophila melanogaster isolate bl3844 lim kinase (Lim1) gene,
           intron 1
          Length = 959

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 759 tgcatttgcatttgcatttgca 780



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 765 tgcatttgcatttgcatttgc 785



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 754 gcatttgcatttgcatttgca 774



to top

>gb|DQ450265.1| Drosophila melanogaster isolate bl3841 lim kinase (Lim1) gene,
           intron 1
          Length = 953

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 753 tgcatttgcatttgcatttgca 774



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 759 tgcatttgcatttgcatttgc 779



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 748 gcatttgcatttgcatttgca 768



to top

>emb|Z46796.1|SC8554 S.cerevisiae chromosome IV cosmid 8554
          Length = 38760

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 8418 tgcatttgcatttgcatttgca 8397



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 8412 tgcatttgcatttgcatttg 8393



to top

>emb|X82086.1|SCCHROIV S.cerevisiae DNA for right arm of chromosome IV
          Length = 32821

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 2777 tgcatttgcatttgcatttgca 2756



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 2771 tgcatttgcatttgcatttg 2752



to top

>emb|AL121806.2|DMBR42I17 Drosophila melanogaster BAC clone BACR42I17
          Length = 155168

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 88893 tgcatttgcatttgcatttgca 88872



to top

>ref|NM_143606.1| Drosophila melanogaster CG15566-RA (CG15566), mRNA
          Length = 645

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 369 tgcatttgcatttgcatttgca 348



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 374 gcatttgcatttgcatttgca 354



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 363 tgcatttgcatttgcatttgc 343



to top

>gb|AC067942.6| Homo sapiens BAC clone RP11-791G16 from 4, complete sequence
          Length = 187399

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 65645 tgcatttgcatttgcatttgca 65624



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 65649 catttgcatttgcatttgca 65630



to top

>gb|AC104410.3| Drosophila melanogaster X BAC RP98-10H22 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 179869

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 103730 tgcatttgcatttgcatttgca 103709



to top

>emb|BX663616.13| Zebrafish DNA sequence from clone DKEY-287H22 in linkage group 7,
             complete sequence
          Length = 150010

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 80791 tgcatttgcatttgcatttgca 80770



to top

>gb|AC095015.1| Drosophila melanogaster, chromosome 3R, region 84A-84B, BAC clone
             BACR32J03, complete sequence
          Length = 190642

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 67749 tgcatttgcatttgcatttgca 67770



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 67743 tgcatttgcatttgcatttgca 67764



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 67737 tgcatttgcatttgcatttgca 67758



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 67731 tgcatttgcatttgcatttgca 67752



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 67727 catttgcatttgcatttgca 67746



to top

>gb|DQ204736.1| Oryza sativa (japonica cultivar-group) cultivar Jefferson brown
            pericarp and seed coat (Rc) pseudogene, complete sequence
          Length = 6429

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 6422 tgcatttgcatttgcatttgca 6401



to top

>gb|DQ204735.1| Oryza sativa (japonica cultivar-group) cultivar H75 brown pericarp
            and seed coat (Rc) gene, complete cds
          Length = 6442

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 6435 tgcatttgcatttgcatttgca 6414



to top

>gb|AE001572.2| Drosophila melanogaster Antennapedia complex (ANT-C),complete sequence
          Length = 429825

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 156062 tgcatttgcatttgcatttgca 156041



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 156056 tgcatttgcatttgcatttgca 156035



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 156050 tgcatttgcatttgcatttgca 156029



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 156044 tgcatttgcatttgcatttgca 156023



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    catttgcatttgcatttgca 138
              ||||||||||||||||||||
Sbjct: 156066 catttgcatttgcatttgca 156047



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 117      tgcatttgcatttgcatttgca 138
                ||||||||||||||||||||||
Sbjct: 26225458 tgcatttgcatttgcatttgca 26225479



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                         
Query: 379     ggcatcgccagcgcggcgtggccgaagccgaagtcggtgtcg 420
               ||||| || ||||| || |||||||| |||||||||||||||
Sbjct: 8092349 ggcatggcgagcgccgcctggccgaacccgaagtcggtgtcg 8092308



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 117     tgcatttgcatttgcatttgca 138
               ||||||||||||||||||||||
Sbjct: 6101462 tgcatttgcatttgcatttgca 6101441



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 117      tgcatttgcatttgcatttgc 137
                |||||||||||||||||||||
Sbjct: 26225464 tgcatttgcatttgcatttgc 26225484



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 118     gcatttgcatttgcatttgca 138
               |||||||||||||||||||||
Sbjct: 2290654 gcatttgcatttgcatttgca 2290634



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 117      tgcatttgcatttgcatttgca 138
                ||||||||||||||||||||||
Sbjct: 27168840 tgcatttgcatttgcatttgca 27168861



to top

>gb|AC009356.3|AC009356 Drosophila melanogaster, chromosome 2R, region 52E-53A, BAC clone
             BACR25I17, complete sequence
          Length = 157835

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 63531 tgcatttgcatttgcatttgca 63510



to top

>gb|AC106743.4| Homo sapiens chromosome 16 clone RP11-116D9, complete sequence
          Length = 117710

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 134   ttgcaggagaagaattaatttagaga 159
             ||||||||| ||||||||||||||||
Sbjct: 92650 ttgcaggaggagaattaatttagaga 92675



to top

>gb|AC008287.4|AC008287 Drosophila melanogaster, chromosome 3R, region 100C-100C, BAC clone
             BACR02G16, complete sequence
          Length = 177480

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 20374 tgcatttgcatttgcatttgca 20353



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 118   gcatttgcatttgcatttgca 138
             |||||||||||||||||||||
Sbjct: 20379 gcatttgcatttgcatttgca 20359



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 117   tgcatttgcatttgcatttgc 137
             |||||||||||||||||||||
Sbjct: 20368 tgcatttgcatttgcatttgc 20348



to top

>gb|AC008230.4|AC008230 Drosophila melanogaster, chromosome 2R, region 53A-53C, BAC clone
             BACR17I17, complete sequence
          Length = 159640

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 40081 tgcatttgcatttgcatttgca 40060



to top

>dbj|AP003309.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBb0036G09
          Length = 124118

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 45256 tgcatttgcatttgcatttgca 45277



to top

>dbj|AP003560.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
            clone:B1060H01
          Length = 157987

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 4929 tgcatttgcatttgcatttgca 4950



to top

>gb|AC018716.4|AC018716 Homo sapiens BAC clone RP11-430H10 from 11, complete sequence
          Length = 179726

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 34931 tgcatttgcatttgcatttgca 34952



to top

>gb|AF272705.1|F4I4 Arabidopsis thaliana BAC F4I4
          Length = 145744

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 13340 tgcatttgcatttgcatttgca 13319



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 13334 tgcatttgcatttgcatttgca 13313



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 13328 tgcatttgcatttgcatttg 13309



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 2525 tgcatttgcatttgcatttg 2506



to top

>dbj|AP004334.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
           PAC clone:P0455H11
          Length = 101607

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 117 tgcatttgcatttgcatttgca 138
           ||||||||||||||||||||||
Sbjct: 86  tgcatttgcatttgcatttgca 107



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 92  tgcatttgcatttgcatttgc 112



to top

>dbj|AP003633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0637D03
          Length = 180159

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 25856 tgcatttgcatttgcatttgca 25877



to top

>dbj|AP003628.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0473H04
          Length = 155204

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 137650 tgcatttgcatttgcatttgca 137671



to top

>dbj|AP005098.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0008C11
          Length = 157205

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 156632 tgcatttgcatttgcatttgca 156611



to top

>dbj|AP005779.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OSJNBb0042J07
          Length = 126938

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 4472 tgcatttgcatttgcatttgca 4451



to top

>dbj|AP003738.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1058_C08
          Length = 117923

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 379   ggcatcgccagcgcggcgtggccgaagccgaagtcggtgtcg 420
             ||||| || ||||| || |||||||| |||||||||||||||
Sbjct: 26121 ggcatggcgagcgccgcctggccgaacccgaagtcggtgtcg 26080



to top

>gb|AF049236.1|AF049236 Arabidopsis thaliana putative transmembrane protein G1p (AtG1),
             putative nuclear DNA-binding protein G2p (AtG2), Em1
             protein (ATEM1), putative chlorophyll synthetase (AtG4),
             putative transmembrane protein G5p (AtG5), putative
             acyl-coA dehydrogenase (AtG6), and calcium dependent
             protein kinase genes, complete cds; and unknown genes
          Length = 60000

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 27029 tgcatttgcatttgcatttgca 27050



to top

>gb|AC157472.3| Medicago truncatula chromosome 7 BAC clone mth2-41h16, complete
             sequence
          Length = 114287

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 38847 tgcatttgcatttgcatttgca 38826



to top

>dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0519E12
          Length = 152448

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 117316 tgcatttgcatttgcatttgca 117337



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 117322 tgcatttgcatttgcatttgc 117342



to top

>emb|Z74369.1|SCYDR073W S.cerevisiae chromosome IV reading frame ORF YDR073w
          Length = 4120

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 2777 tgcatttgcatttgcatttgca 2756



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 2771 tgcatttgcatttgcatttg 2752



to top

>gb|AC001653.1|AC001653 Drosophila melanogaster, chromosome 3R, region 84B1-84B2, P1 clone
             DS07876, complete sequence
          Length = 66991

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 62996 tgcatttgcatttgcatttgca 63017



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 62990 tgcatttgcatttgcatttgca 63011



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 62984 tgcatttgcatttgcatttgca 63005



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 62978 tgcatttgcatttgcatttgca 62999



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 62974 catttgcatttgcatttgca 62993



to top

>gb|AE003673.3| Drosophila melanogaster chromosome 3R, section 11 of 118 of the complete
              sequence
          Length = 308146

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 122609 tgcatttgcatttgcatttgca 122630



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 122603 tgcatttgcatttgcatttgca 122624



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 122597 tgcatttgcatttgcatttgca 122618



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 122591 tgcatttgcatttgcatttgca 122612



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 119    catttgcatttgcatttgca 138
              ||||||||||||||||||||
Sbjct: 122587 catttgcatttgcatttgca 122606



to top

>gb|AE003807.3| Drosophila melanogaster chromosome 2R, section 43 of 73 of the complete
             sequence
          Length = 258223

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 99146 tgcatttgcatttgcatttgca 99125



to top

>gb|AE003778.3| Drosophila melanogaster chromosome 3R, section 116 of 118 of the
            complete sequence
          Length = 225974

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 117  tgcatttgcatttgcatttgca 138
            ||||||||||||||||||||||
Sbjct: 2641 tgcatttgcatttgcatttgca 2620



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 118  gcatttgcatttgcatttgca 138
            |||||||||||||||||||||
Sbjct: 2646 gcatttgcatttgcatttgca 2626



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 117  tgcatttgcatttgcatttgc 137
            |||||||||||||||||||||
Sbjct: 2635 tgcatttgcatttgcatttgc 2615



to top

>gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 of 74 of the complete
             sequence
          Length = 308311

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 44973 tgcatttgcatttgcatttgca 44952



to top

>gb|AC004318.1|AC004318 Drosophila melanogaster DNA sequence (P1 DS06464 (D212)), complete
             sequence
          Length = 86188

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 64890 tgcatttgcatttgcatttgca 64869



to top

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 117     tgcatttgcatttgcatttgca 138
               ||||||||||||||||||||||
Sbjct: 1520754 tgcatttgcatttgcatttgca 1520733



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 119     catttgcatttgcatttgca 138
               ||||||||||||||||||||
Sbjct: 1520758 catttgcatttgcatttgca 1520739



to top

>dbj|AP004579.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT11E23, TM0557
          Length = 87695

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 117   tgcatttgcatttgcatttgca 138
             ||||||||||||||||||||||
Sbjct: 17634 tgcatttgcatttgcatttgca 17655



to top

>dbj|AP004578.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT17H01, TM0541,
              complete sequence
          Length = 110985

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 117    tgcatttgcatttgcatttgca 138
              ||||||||||||||||||||||
Sbjct: 105237 tgcatttgcatttgcatttgca 105258



to top

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 119     catttgcatttgcatttgcag 139
               |||||||||||||||||||||
Sbjct: 1149368 catttgcatttgcatttgcag 1149348



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 377     ccggcatcgccagcgcggcg 396
               ||||||||||||||||||||
Sbjct: 3198311 ccggcatcgccagcgcggcg 3198292



to top

>ref|XM_635042.1| Dictyostelium discoideum hypothetical protein (DDB0204846), partial
           mRNA
          Length = 1227

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 119 catttgcatttgcatttgcag 139
           |||||||||||||||||||||
Sbjct: 961 catttgcatttgcatttgcag 941



to top

>gb|AC164176.12| Mus musculus 10 BAC RP23-8O18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 216064

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 157052 tgcatttgcatttgcatttgc 157032



to top

>gb|AY392542.1| Porcine teschovirus isolate 2-AK-III polyprotein gene, partial cds
          Length = 3583

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 126  atttgcatttgcaggagaaga 146
            |||||||||||||||||||||
Sbjct: 2318 atttgcatttgcaggagaaga 2338



to top

>gb|AY392541.1| Porcine teschovirus isolate 12-PL polyprotein gene, partial cds
          Length = 3857

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 126  atttgcatttgcaggagaaga 146
            |||||||||||||||||||||
Sbjct: 2312 atttgcatttgcaggagaaga 2332



to top

>gb|AC168279.3| Mus musculus 10 BAC RP23-345H24 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 196860

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 154885 tgcatttgcatttgcatttgc 154905



to top

>gb|AC151537.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0087D01, complete sequence
          Length = 83225

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   gcatttgcatttgcatttgca 138
             |||||||||||||||||||||
Sbjct: 45348 gcatttgcatttgcatttgca 45368



to top

>gb|AC151407.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0073M15,
              complete sequence
          Length = 143071

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 118    gcatttgcatttgcatttgca 138
              |||||||||||||||||||||
Sbjct: 124247 gcatttgcatttgcatttgca 124267



to top

>emb|CR715518.2|CNS0GF1M Tetraodon nigroviridis full-length cDNA
          Length = 1081

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 223 tgcatttgcatttgcatttgc 203



to top

>gb|AC090711.3| Homo sapiens chromosome 8 clone RP11-89H1 map 8q21-q23, complete
             sequence
          Length = 153053

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 20    atttattcaatggagaaacttttacaact 48
             |||| ||||||||| ||||||||||||||
Sbjct: 35388 attttttcaatggaaaaacttttacaact 35360



to top

>emb|AL451005.9| Human DNA sequence from clone RP11-92B10 on chromosome X Contains the
             5' end of a variant of the CUL4B gene for cullin 4B and
             the 5' end of a variant of the gene for MCT-1 protein
             (MCT-1), complete sequence
          Length = 26768

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 301   atccacgttcctgggtttccc 321
             |||||||||||||||||||||
Sbjct: 17593 atccacgttcctgggtttccc 17573



to top

>gb|DQ450278.1| Drosophila melanogaster isolate tu1402102317 lim kinase (Lim1)
           gene, intron 1
          Length = 946

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 752 tgcatttgcatttgcatttgc 772



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 747 gcatttgcatttgcatttgca 767



to top

>gb|DQ450277.1| Drosophila melanogaster isolate tu1402102316 lim kinase (Lim1)
           gene, intron 1
          Length = 947

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 753 tgcatttgcatttgcatttgc 773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 748 gcatttgcatttgcatttgca 768



to top

>gb|DQ450276.1| Drosophila melanogaster isolate tu1402102314 lim kinase (Lim1)
           gene, intron 1
          Length = 947

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 753 tgcatttgcatttgcatttgc 773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 748 gcatttgcatttgcatttgca 768



to top

>gb|DQ450275.1| Drosophila melanogaster isolate tu1402102311 lim kinase (Lim1)
           gene, intron 1
          Length = 935

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 741 tgcatttgcatttgcatttgc 761



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 736 gcatttgcatttgcatttgca 756



to top

>gb|DQ450272.1| Drosophila melanogaster isolate bl3875 lim kinase (Lim1) gene,
           intron 1
          Length = 947

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 753 tgcatttgcatttgcatttgc 773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 748 gcatttgcatttgcatttgca 768



to top

>gb|DQ450269.1| Drosophila melanogaster isolate bl3853 lim kinase (Lim1) gene,
           intron 1
          Length = 945

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 751 tgcatttgcatttgcatttgc 771



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 746 gcatttgcatttgcatttgca 766



to top

>gb|DQ450268.1| Drosophila melanogaster isolate bl3852 lim kinase (Lim1) gene,
           intron 1
          Length = 947

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 753 tgcatttgcatttgcatttgc 773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 748 gcatttgcatttgcatttgca 768



to top

>gb|DQ450264.1| Drosophila melanogaster isolate bl3839 lim kinase (Lim1) gene,
           intron 1
          Length = 947

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 753 tgcatttgcatttgcatttgc 773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 748 gcatttgcatttgcatttgca 768



to top

>gb|DQ450263.1| Drosophila melanogaster isolate bl1 lim kinase (Lim1) gene, intron
           1
          Length = 947

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 753 tgcatttgcatttgcatttgc 773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 748 gcatttgcatttgcatttgca 768



to top

>gb|AC023748.4| Drosophila melanogaster X BAC RP98-36F8 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 156096

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 118    gcatttgcatttgcatttgca 138
              |||||||||||||||||||||
Sbjct: 103648 gcatttgcatttgcatttgca 103628



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 103643 tgcatttgcatttgcatttgc 103623



to top

>gb|AC023718.4| Drosophila melanogaster X BAC RP98-7P15 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 164415

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   gcatttgcatttgcatttgca 138
             |||||||||||||||||||||
Sbjct: 82165 gcatttgcatttgcatttgca 82185



to top

>tpg|BK003634.1| TPA: TPA_inf: Drosophila melanogaster HDC04273 (HDC04273) gene,
           complete cds
          Length = 405

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 117 tgcatttgcatttgcatttgc 137
           |||||||||||||||||||||
Sbjct: 8   tgcatttgcatttgcatttgc 28



to top

>gb|AC087110.3| Homo sapiens chromosome 8, clone CTD-2033B22, complete sequence
          Length = 145544

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 20    atttattcaatggagaaacttttacaact 48
             |||| ||||||||| ||||||||||||||
Sbjct: 84355 attttttcaatggaaaaacttttacaact 84383



to top

>gb|AC092190.1|AC092190 Drosophila melanogaster, chromosome X, region 20C-20D, BAC clone
             BACR08A09, complete sequence
          Length = 172266

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 118   gcatttgcatttgcatttgca 138
             |||||||||||||||||||||
Sbjct: 41190 gcatttgcatttgcatttgca 41170



to top

>gb|AC021325.5|AC021325 Homo sapiens chromosome , clone RP11-23N15, complete sequence
          Length = 180568

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 147   attaatttagagacgaggtct 167
             |||||||||||||||||||||
Sbjct: 27684 attaatttagagacgaggtct 27664



to top

>gb|AC007144.13|AC007144 Drosophila melanogaster, chromosome 2L, region 38F-39A, BAC clone
              BACR06G10, complete sequence
          Length = 176082

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 110875 tgcatttgcatttgcatttgc 110895



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 117      tgcatttgcatttgcatttgc 137
                |||||||||||||||||||||
Sbjct: 28064685 tgcatttgcatttgcatttgc 28064665



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 117     tgcatttgcatttgcatttgc 137
               |||||||||||||||||||||
Sbjct: 7248446 tgcatttgcatttgcatttgc 7248426



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 117      tgcatttgcatttgcatttg 136
                ||||||||||||||||||||
Sbjct: 35156207 tgcatttgcatttgcatttg 35156226



to top

>gb|AC008304.3|AC008304 Drosophila melanogaster, chromosome 2R, region 59D2-59D3, BAC clone
             BACR04G19, complete sequence
          Length = 181955

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 117   tgcatttgcatttgcatttgc 137
             |||||||||||||||||||||
Sbjct: 74294 tgcatttgcatttgcatttgc 74314



to top

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 119     catttgcatttgcatttgcag 139
               |||||||||||||||||||||
Sbjct: 1152260 catttgcatttgcatttgcag 1152240



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 377     ccggcatcgccagcgcggcg 396
               ||||||||||||||||||||
Sbjct: 3186973 ccggcatcgccagcgcggcg 3186954



to top

>gb|AC023724.5| Drosophila melanogaster X BAC RP98-14B2 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 181974

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 118   gcatttgcatttgcatttgca 138
             |||||||||||||||||||||
Sbjct: 71583 gcatttgcatttgcatttgca 71563



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 117   tgcatttgcatttgcatttgc 137
             |||||||||||||||||||||
Sbjct: 71578 tgcatttgcatttgcatttgc 71558



to top

>dbj|AP005524.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0562A06
          Length = 154198

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 142177 tgcatttgcatttgcatttgc 142157



to top

>gb|AF246419.1|AF246419 Acidithiobacillus ferroxidans aspartate aminotransferase gene,
           partial sequence
          Length = 1602

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 391 gcggcgtggccgaagccgaag 411
           |||||||||||||||||||||
Sbjct: 732 gcggcgtggccgaagccgaag 752



to top

>emb|BX005447.8| Zebrafish DNA sequence from clone DKEY-29B14, complete sequence
          Length = 283185

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 119    catttgcatttgcatttgcag 139
              |||||||||||||||||||||
Sbjct: 190928 catttgcatttgcatttgcag 190948



to top

>dbj|AP005394.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0620H05
          Length = 161808

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 148383 tgcatttgcatttgcatttgc 148363



to top

>dbj|AP005756.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0035N08
          Length = 136267

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 117   tgcatttgcatttgcatttgc 137
             |||||||||||||||||||||
Sbjct: 24254 tgcatttgcatttgcatttgc 24234



to top

>dbj|AP005544.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0604E01
          Length = 159049

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 117   tgcatttgcatttgcatttgc 137
             |||||||||||||||||||||
Sbjct: 62180 tgcatttgcatttgcatttgc 62160



to top

>dbj|AK100833.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123D15, full
           insert sequence
          Length = 1037

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 118 gcatttgcatttgcatttgca 138
           |||||||||||||||||||||
Sbjct: 672 gcatttgcatttgcatttgca 652



to top

>emb|AL391749.4|CNS06C8I Human chromosome 14 DNA sequence BAC R-233L14 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 195007

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 119695 tgcatttgcatttgcatttgc 119675



to top

>dbj|AP003824.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1343_B12
          Length = 121362

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 118   gcatttgcatttgcatttgca 138
             |||||||||||||||||||||
Sbjct: 64353 gcatttgcatttgcatttgca 64333



to top

>gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77 of 83 of the complete
              sequence
          Length = 270158

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 209693 tgcatttgcatttgcatttgc 209713



to top

>gb|AE003573.4| Drosophila melanogaster chromosome X, section 74 of 74 of the complete
             sequence
          Length = 313035

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   gcatttgcatttgcatttgca 138
             |||||||||||||||||||||
Sbjct: 51610 gcatttgcatttgcatttgca 51630



to top

>gb|AE003486.2| Drosophila melanogaster chromosome X, section 38 of 74 of the complete
             sequence
          Length = 328128

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   gcatttgcatttgcatttgca 138
             |||||||||||||||||||||
Sbjct: 79393 gcatttgcatttgcatttgca 79413



to top

>gb|AE003460.2| Drosophila melanogaster chromosome 2R, section 68 of 73 of the complete
              sequence
          Length = 299331

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    tgcatttgcatttgcatttgc 137
              |||||||||||||||||||||
Sbjct: 126771 tgcatttgcatttgcatttgc 126791



to top

>gb|AE003445.2| Drosophila melanogaster chromosome X, section 29 of 74 of the complete
             sequence
          Length = 334222

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 117   tgcatttgcatttgcatttgc 137
             |||||||||||||||||||||
Sbjct: 82745 tgcatttgcatttgcatttgc 82765



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   gcatttgcatttgcatttgca 138
             |||||||||||||||||||||
Sbjct: 82740 gcatttgcatttgcatttgca 82760



to top

>dbj|AB085897.1| Cucumis sativus CS-PIN1 mRNA for PIN1-like auxin transport protein,
            complete cds
          Length = 2262

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 118  gcatttgcatttgcatttgca 138
            |||||||||||||||||||||
Sbjct: 1103 gcatttgcatttgcatttgca 1083



to top

>gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome
          Length = 3730232

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 344     accccgtgcacagcctgccg 363
               ||||||||||||||||||||
Sbjct: 3446202 accccgtgcacagcctgccg 3446221



to top

>ref|XM_629023.1| Dictyostelium discoideum hypothetical protein (DDB0192024), partial
            mRNA
          Length = 6045

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 1814 tgcatttgcatttgcatttg 1795



to top

>ref|NM_032037.2| Homo sapiens testis-specific serine kinase 6 (TSSK6), mRNA
          Length = 1442

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 398 ggccgaagccgaagtcggtg 417
           ||||||||||||||||||||
Sbjct: 708 ggccgaagccgaagtcggtg 689



to top

>gb|AC005965.1| Arabidopsis thaliana BAC T19G15, from chromosome V near 60.5 cM,
             complete sequence
          Length = 77036

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 67971 tgcatttgcatttgcatttg 67952



to top

>gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1007D10,
             complete sequence
          Length = 153366

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    tttatttattcaatggagaa 36
             ||||||||||||||||||||
Sbjct: 63221 tttatttattcaatggagaa 63240



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 405     gccgaagtcggtgtcgttgg 424
               ||||||||||||||||||||
Sbjct: 5901628 gccgaagtcggtgtcgttgg 5901609



to top

>gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence
          Length = 1653225

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 118    gcatttgcatttgcatttgc 137
              ||||||||||||||||||||
Sbjct: 742306 gcatttgcatttgcatttgc 742287



to top

>gb|AC120539.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0063D09
              map S1559, complete sequence
          Length = 190721

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 119    catttgcatttgcatttgca 138
              ||||||||||||||||||||
Sbjct: 107145 catttgcatttgcatttgca 107164



to top

>gb|AC104642.11| Trypanosoma brucei chromosome 3 clone RPCI93-27C5, complete sequence
          Length = 126762

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   gcatttgcatttgcatttgc 137
             ||||||||||||||||||||
Sbjct: 51254 gcatttgcatttgcatttgc 51235



to top

>gb|AC016158.4| Drosophila melanogaster clone BACR38H07, complete sequence
          Length = 172841

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 118    gcatttgcatttgcatttgc 137
              ||||||||||||||||||||
Sbjct: 123095 gcatttgcatttgcatttgc 123114



to top

>gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete sequence
          Length = 176395

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 77525 tgcatttgcatttgcatttg 77544



to top

>ref|XM_709592.1| Candida albicans SC5314 hypothetical protein (CaO19.6979), mRNA
          Length = 2343

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 119  catttgcatttgcatttgca 138
            ||||||||||||||||||||
Sbjct: 1387 catttgcatttgcatttgca 1368



to top

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 405    gccgaagtcggtgtcgttgg 424
              ||||||||||||||||||||
Sbjct: 486896 gccgaagtcggtgtcgttgg 486877



to top

>gb|AY264885.1|AY227363S2 Zea mays MADS-box transcription factor MADS2 (mads2) gene, exons 3
            through 8, and complete cds
          Length = 2598

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 1128 tgcatttgcatttgcatttg 1147



to top

>ref|XM_751533.1| Ustilago maydis 521 hypothetical protein (UM00479.1) partial mRNA
          Length = 4668

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 4457 tgcatttgcatttgcatttg 4438



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 405     gccgaagtcggtgtcgttgg 424
               ||||||||||||||||||||
Sbjct: 4907524 gccgaagtcggtgtcgttgg 4907543



to top

>ref|XM_820523.1| Trypanosoma brucei TREU927 clone RPCI93-27C5 hypothetical protein
           (Tb927.3.2870) partial mRNA
          Length = 1965

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 118 gcatttgcatttgcatttgc 137
           ||||||||||||||||||||
Sbjct: 60  gcatttgcatttgcatttgc 79



to top

>ref|XM_750891.1| Aspergillus fumigatus Af293 ubiquitin conjugating enzyme UbcF
           (Afu2g16470) partial mRNA
          Length = 939

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 118 gcatttgcatttgcatttgc 137
           ||||||||||||||||||||
Sbjct: 656 gcatttgcatttgcatttgc 637



to top

>gb|AE014311.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 8
             of 11 of the complete sequence
          Length = 250029

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 86810 tgcatttgcatttgcatttg 86829



to top

>gb|AC146133.3| Pan troglodytes BAC clone RP43-38C10 from 7, complete sequence
          Length = 168763

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 70775 tgcatttgcatttgcatttg 70756



to top

>ref|XM_723534.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY01087)
            partial mRNA
          Length = 4725

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 119  catttgcatttgcatttgca 138
            ||||||||||||||||||||
Sbjct: 3541 catttgcatttgcatttgca 3522



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 3537 tgcatttgcatttgcatttg 3518



to top

>ref|XM_960987.1| Plasmodium falciparum 3D7 hypothetical protein (PFF0445w) partial
            mRNA
          Length = 18234

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 7500 tgcatttgcatttgcatttg 7481



to top

>gb|U41992.1| Caenorhabditis elegans cosmid F32E10, complete sequence
          Length = 33318

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 119  catttgcatttgcatttgca 138
            ||||||||||||||||||||
Sbjct: 3924 catttgcatttgcatttgca 3943



to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 377     ccggcatcgccagcgcggcg 396
               ||||||||||||||||||||
Sbjct: 3649866 ccggcatcgccagcgcggcg 3649847



to top

>emb|CR759789.8| Zebrafish DNA sequence from clone CH211-153M1, complete sequence
          Length = 165831

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 47218 catttgcatttgcatttgca 47199



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 377     ccggcatcgccagcgcggcg 396
               ||||||||||||||||||||
Sbjct: 3437082 ccggcatcgccagcgcggcg 3437063



to top

>emb|AL606823.4| Human DNA sequence from clone RP11-49K6 on chromosome 13, complete
            sequence
          Length = 39184

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 4798 tgcatttgcatttgcatttg 4817



to top

>emb|AL356967.23| Human DNA sequence from clone RP11-427E4 on chromosome 6 Contains a
             novel pseudogene, complete sequence
          Length = 163869

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    attcaatggagaaactttta 43
             ||||||||||||||||||||
Sbjct: 39215 attcaatggagaaactttta 39196



to top

>gb|AC124926.7| Rattus norvegicus X BAC CH230-155H3 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 217309

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 118    gcatttgcatttgcatttgc 137
              ||||||||||||||||||||
Sbjct: 210115 gcatttgcatttgcatttgc 210134



to top

>gb|AC093489.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1116_A10,
             complete sequence
          Length = 102275

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    tttatttattcaatggagaa 36
             ||||||||||||||||||||
Sbjct: 62061 tttatttattcaatggagaa 62080



to top

>emb|Z98547.2|PFMAL3P3 Plasmodium falciparum MAL3P3, complete sequence
          Length = 116696

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 80341 catttgcatttgcatttgca 80360



to top

>emb|CR382399.1| Plasmodium falciparum chromosome 6, complete sequence; segment 2/5
          Length = 348174

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 28388 tgcatttgcatttgcatttg 28369



to top

>gb|BC014611.2| Homo sapiens testis-specific serine kinase 6, mRNA (cDNA clone
           MGC:26987 IMAGE:4826305), complete cds
          Length = 1345

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 398 ggccgaagccgaagtcggtg 417
           ||||||||||||||||||||
Sbjct: 596 ggccgaagccgaagtcggtg 577



to top

>emb|AL161511.2|ATCHRIV23 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 23
          Length = 197306

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 117    tgcatttgcatttgcatttg 136
              ||||||||||||||||||||
Sbjct: 130213 tgcatttgcatttgcatttg 130232



to top

>emb|BX927166.14| Zebrafish DNA sequence from clone DKEY-28M24 in linkage group 18,
             complete sequence
          Length = 108091

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   atgcatttgcatttgcattt 135
             ||||||||||||||||||||
Sbjct: 45958 atgcatttgcatttgcattt 45977



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 405     gccgaagtcggtgtcgttgg 424
               ||||||||||||||||||||
Sbjct: 6570044 gccgaagtcggtgtcgttgg 6570025



to top

>gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 192681

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 94411 catttgcatttgcatttgca 94430



to top

>gb|AC011448.5| Homo sapiens chromosome 19 clone CTC-260F20, complete sequence
          Length = 165122

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 398   ggccgaagccgaagtcggtg 417
             ||||||||||||||||||||
Sbjct: 77052 ggccgaagccgaagtcggtg 77071



to top

>gb|AC113619.5| Drosophila melanogaster X BAC RP98-22D21 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 160001

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 118   gcatttgcatttgcatttgc 137
             ||||||||||||||||||||
Sbjct: 77156 gcatttgcatttgcatttgc 77175



to top

>gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 177096

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 117    tgcatttgcatttgcatttg 136
              ||||||||||||||||||||
Sbjct: 113780 tgcatttgcatttgcatttg 113761



to top

>gb|AC010031.8| Drosophila melanogaster 3L BAC RP98-2M20 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 173509

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 117    tgcatttgcatttgcatttg 136
              ||||||||||||||||||||
Sbjct: 106546 tgcatttgcatttgcatttg 106527



to top

>gb|AC149226.11| Danio rerio clone ch211-252j18, complete sequence
          Length = 154059

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gaaggcaaactggagcttta 20
             ||||||||||||||||||||
Sbjct: 69953 gaaggcaaactggagcttta 69972



to top

>gb|AC023710.5| Drosophila melanogaster X BAC RP98-19D3 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 189976

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 118  gcatttgcatttgcatttgc 137
            ||||||||||||||||||||
Sbjct: 9077 gcatttgcatttgcatttgc 9058



to top

>tpg|BK002861.1| TPA: TPA_inf: Drosophila melanogaster HDC15820 (HDC15820) gene,
            complete cds
          Length = 1544

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 119  catttgcatttgcatttgca 138
            ||||||||||||||||||||
Sbjct: 1317 catttgcatttgcatttgca 1298



to top

>gb|AE012068.1| Xanthomonas axonopodis pv. citri str. 306,  section 446 of 469 of the
            complete genome
          Length = 10884

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 405  gccgaagtcggtgtcgttgg 424
            ||||||||||||||||||||
Sbjct: 5223 gccgaagtcggtgtcgttgg 5242



to top

>gb|AC007167.5| Arabidopsis thaliana chromosome 2 clone F3C11 map mi310, complete
             sequence
          Length = 103874

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 35310 tgcatttgcatttgcatttg 35329



to top

>gb|AC006446.4| Arabidopsis thaliana chromosome 2 clone F15O11 map PRI, complete
             sequence
          Length = 91688

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 53621 tgcatttgcatttgcatttg 53640



to top

>gb|AC027251.6| Homo sapiens chromosome 8, clone RP11-14G5, complete sequence
          Length = 130377

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   atgcatttgcatttgcattt 135
             ||||||||||||||||||||
Sbjct: 25264 atgcatttgcatttgcattt 25245



to top

>gb|DP000033.1| Carollia perspicillata target 116 genomic scaffold
          Length = 347743

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    catttgcatttgcatttgca 138
              ||||||||||||||||||||
Sbjct: 268087 catttgcatttgcatttgca 268068



to top

>gb|AC155282.1| Medicago truncatula chromosome 2 BAC clone mth2-63e12, complete
             sequence
          Length = 251117

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 30820 catttgcatttgcatttgca 30801



to top

>gb|AC159628.2| Mus musculus BAC clone RP24-206C4 from chromosome 12, complete sequence
          Length = 161791

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     aaggcaaactggagctttat 21
             ||||||||||||||||||||
Sbjct: 64903 aaggcaaactggagctttat 64884



to top

>gb|AF348077.1|AF348077 Homo sapiens serine/threonine kinase FKSG82 (FKSG82) mRNA, complete
           cds
          Length = 1467

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 398 ggccgaagccgaagtcggtg 417
           ||||||||||||||||||||
Sbjct: 733 ggccgaagccgaagtcggtg 714



to top

>gb|AY335719.1| Synthetic construct Homo sapiens serine/threonine protein kinase
           SSTK (SSTK) mRNA, partial cds
          Length = 822

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 398 ggccgaagccgaagtcggtg 417
           ||||||||||||||||||||
Sbjct: 475 ggccgaagccgaagtcggtg 456



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 17      tttatttattcaatggagaa 36
               ||||||||||||||||||||
Sbjct: 5376547 tttatttattcaatggagaa 5376566



to top

>gb|AC009981.6|AC009981 Drosophila melanogaster, chromosome 3R, region 97C-97D, BAC clone
              BACR24O14, complete sequence
          Length = 170356

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    catttgcatttgcatttgca 138
              ||||||||||||||||||||
Sbjct: 110546 catttgcatttgcatttgca 110527



to top

>gb|AC008358.4|AC008358 Drosophila melanogaster, chromosome 3R, region 86E-86E, BAC clone
             BACR48B07, complete sequence
          Length = 170307

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 90429 catttgcatttgcatttgca 90448



to top

>gb|AC007710.11|AC007710 Drosophila melanogaster, chromosome 3R, region 86E-86E, BAC clone
             BACR05C15, complete sequence
          Length = 174426

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 40950 catttgcatttgcatttgca 40969



to top

>gb|AF329483.1| Homo sapiens serine/threonine protein kinase SSTK (SSTK) mRNA,
           complete cds
          Length = 1554

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 398 ggccgaagccgaagtcggtg 417
           ||||||||||||||||||||
Sbjct: 597 ggccgaagccgaagtcggtg 578



to top

>gb|AC013437.8| Homo sapiens BAC clone RP11-190J23 from 2, complete sequence
          Length = 167424

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 117    tgcatttgcatttgcatttg 136
              ||||||||||||||||||||
Sbjct: 116125 tgcatttgcatttgcatttg 116106



to top

>dbj|AP004048.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1202_E07
          Length = 145014

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 51563 tgcatttgcatttgcatttg 51582



to top

>dbj|AK172841.1| Homo sapiens cDNA FLJ24002 fis, clone KAIA4350, highly similar to
            Homo sapiens serine/threonine protein kinase SSTK (SSTK)
          Length = 2535

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 398  ggccgaagccgaagtcggtg 417
            ||||||||||||||||||||
Sbjct: 1077 ggccgaagccgaagtcggtg 1058



to top

>dbj|AB028618.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MOD1
          Length = 85690

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tgcatttgcatttgcatttg 136
           ||||||||||||||||||||
Sbjct: 237 tgcatttgcatttgcatttg 256



to top

>dbj|AB005248.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI10
          Length = 83646

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 34577 tgcatttgcatttgcatttg 34596



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 24444 tgcatttgcatttgcatttg 24463



to top

>emb|AL110116.1|ATC18G5 Arabidopsis thaliana DNA chromosome 4, BAC clone C18G5, partial
            sequence (ESSA project)
          Length = 30649

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 9701 tgcatttgcatttgcatttg 9720



to top

>dbj|AK058166.1| Homo sapiens cDNA FLJ25437 fis, clone TST08312
          Length = 1266

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 398 ggccgaagccgaagtcggtg 417
           ||||||||||||||||||||
Sbjct: 553 ggccgaagccgaagtcggtg 534



to top

>dbj|AK069089.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008B14, full
            insert sequence
          Length = 3756

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   tttatttattcaatggagaa 36
            ||||||||||||||||||||
Sbjct: 3680 tttatttattcaatggagaa 3699



to top

>gb|AF077407.1|F9D12 Arabidopsis thaliana BAC F9D12
          Length = 112253

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 56721 tgcatttgcatttgcatttg 56702



to top

>emb|AL445363.7|CNS07ECY Human chromosome 14 DNA sequence BAC R-671J11 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181987

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 148    ttaatttagagacgaggtct 167
              ||||||||||||||||||||
Sbjct: 120425 ttaatttagagacgaggtct 120406



to top

>emb|AL132951.3|CEY67H2A Caenorhabditis elegans YAC Y67H2A, complete sequence
          Length = 57745

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 24058 tgcatttgcatttgcatttg 24039



to top

>emb|BX957286.14| Zebrafish DNA sequence from clone CH211-119B12 in linkage group 20,
             complete sequence
          Length = 161104

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    tggcaacacaatgcaacaaa 67
             ||||||||||||||||||||
Sbjct: 96448 tggcaacacaatgcaacaaa 96467



to top

>gb|AY110277.1| Zea mays CL615_-1 mRNA sequence
          Length = 982

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 289 aaggcgctgatgatccacgt 308
           ||||||||||||||||||||
Sbjct: 617 aaggcgctgatgatccacgt 636



to top

>gb|AE003758.4| Drosophila melanogaster chromosome 3R, section 96 of 118 of the
             complete sequence
          Length = 228635

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 64062 catttgcatttgcatttgca 64043



to top

>gb|AE003730.3| Drosophila melanogaster chromosome 3R, section 68 of 118 of the
             complete sequence
          Length = 221402

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 118   gcatttgcatttgcatttgc 137
             ||||||||||||||||||||
Sbjct: 88422 gcatttgcatttgcatttgc 88441



to top

>gb|AE003691.4| Drosophila melanogaster chromosome 3R, section 29 of 118 of the
             complete sequence
          Length = 266829

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 61220 catttgcatttgcatttgca 61239



to top

>gb|AE003705.3| Drosophila melanogaster chromosome 3R, section 43 of 118 of the
            complete sequence
          Length = 216741

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 117  tgcatttgcatttgcatttg 136
            ||||||||||||||||||||
Sbjct: 7559 tgcatttgcatttgcatttg 7540



to top

>gb|AE003536.4| Drosophila melanogaster chromosome 3L, section 49 of 83 of the complete
              sequence
          Length = 350428

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 117    tgcatttgcatttgcatttg 136
              ||||||||||||||||||||
Sbjct: 153574 tgcatttgcatttgcatttg 153593



to top

>gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 of 83 of the complete
             sequence
          Length = 301691

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   catttgcatttgcatttgca 138
             ||||||||||||||||||||
Sbjct: 90783 catttgcatttgcatttgca 90802



to top

>gb|AE003436.3| Drosophila melanogaster chromosome X, section 20 of 74 of the complete
              sequence
          Length = 317322

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 118    gcatttgcatttgcatttgc 137
              ||||||||||||||||||||
Sbjct: 316198 gcatttgcatttgcatttgc 316179



to top

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
              sequence
          Length = 304204

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 117    tgcatttgcatttgcatttg 136
              ||||||||||||||||||||
Sbjct: 176090 tgcatttgcatttgcatttg 176071



to top

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 117     tgcatttgcatttgcatttg 136
               ||||||||||||||||||||
Sbjct: 1997787 tgcatttgcatttgcatttg 1997806



to top

>emb|CR536612.8| Zebrafish DNA sequence from clone DKEY-1O1 in linkage group 15,
             complete sequence
          Length = 224998

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     gaaggcaaactggagcttta 20
             ||||||||||||||||||||
Sbjct: 25502 gaaggcaaactggagcttta 25483



to top

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 377     ccggcatcgccagcgcggcg 396
               ||||||||||||||||||||
Sbjct: 3009575 ccggcatcgccagcgcggcg 3009556



to top

>gb|AC115031.11| Mus musculus chromosome 3, clone RP24-257J5, complete sequence
          Length = 170460

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 25     ttcaatggagaaacttttacaact 48
              ||||||||| ||||||||||||||
Sbjct: 151426 ttcaatggaaaaacttttacaact 151403



to top

>emb|AL009146.1|DMC17A9 Drosophila melanogaster cosmid 17A9
          Length = 39582

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tgcatttgcatttgcatttg 136
             ||||||||||||||||||||
Sbjct: 14352 tgcatttgcatttgcatttg 14333



to top

>dbj|AB071804.1| Oryza sativa (japonica cultivar-group) mRNA for transcription factor
            PCF3, partial cds
          Length = 1649

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 119  catttgcatttgcatttgca 138
            ||||||||||||||||||||
Sbjct: 1349 catttgcatttgcatttgca 1330


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,726,440
Number of Sequences: 3902068
Number of extensions: 3726440
Number of successful extensions: 79809
Number of sequences better than 10.0: 214
Number of HSP's better than 10.0 without gapping: 217
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 78181
Number of HSP's gapped (non-prelim): 1481
length of query: 469
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 447
effective length of database: 17,147,199,772
effective search space: 7664798298084
effective search space used: 7664798298084
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top