ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart49c03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds Length = 1233 Score = 307 bits (155), Expect = 2e-80 Identities = 224/247 (90%) Strand = Plus / Minus Query: 220 catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 279 |||||||||||| |||||||| ||||||||||| |||||||||||||| | ||| |||| Sbjct: 1148 catctacttagtgaactcgatggcccatgcgttggcgtagatgtaagtagtcttcatggc 1089 Query: 280 ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 339 |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| Sbjct: 1088 ggcgaacccggcgcccttggccagggcctcgaactccctctcgtacctctccctgccacc 1029 Query: 340 tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 399 |||||||||||||||||||||||||| | | |||||| ||||| |||||||| || || Sbjct: 1028 cgggttgtgcgcgagcatgatcatgtcgacatggaacaccccctgcgccttaggcgtcgc 969 Query: 400 ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 459 ||||| || || ||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 968 ctccgggttcacaggcaggatgcactccacgagcaccaccttgccgtgcgccggcaacgc 909 Query: 460 gtcgtag 466 ||||||| Sbjct: 908 gtcgtag 902
>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA, complete cds Length = 1371 Score = 276 bits (139), Expect = 6e-71 Identities = 223/251 (88%) Strand = Plus / Minus Query: 216 catgcatctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttga 275 |||| |||||||| || |||||||| || ||||||| |||||||||||||||| ||||| Sbjct: 1163 catggatctacttggtgaactcgatggcaaatgcgttggcgtagatgtaagtggtcttga 1104 Query: 276 tggaggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctac 335 ||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||| | Sbjct: 1103 tggctttgaagccggcgcccttggccagggcctcgaactccctctcgtacctctccctgc 1044 Query: 336 cacctgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttagggg 395 | || |||||||||||||||||||||||||| | || |||||| ||||| ||||| || | Sbjct: 1043 cgccggggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgccttgggcg 984 Query: 396 tagcttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggca 455 | || ||||| || |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 983 tggcctccgggttcaccggcaggatgcactccacgagcaccaccttgccgtgcgccggca 924 Query: 456 gcgcgtcgtag 466 ||||||||||| Sbjct: 923 gcgcgtcgtag 913
>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA sequence Length = 1314 Score = 260 bits (131), Expect = 4e-66 Identities = 221/251 (88%) Strand = Plus / Minus Query: 216 catgcatctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttga 275 |||| |||||||| || |||||||| || ||||||| ||||||||||| |||| ||||| Sbjct: 1083 catggatctacttggtgaactcgatggcaaatgcgttggcgtagatgtaggtggtcttga 1024 Query: 276 tggaggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctac 335 ||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||| | Sbjct: 1023 tggctttgaagccggcgcccttggccagggcctcgaactccctctcgtacctctccctgc 964 Query: 336 cacctgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttagggg 395 | || |||||||||||||||||||||||||| | || ||| || ||||| ||||| || | Sbjct: 963 cgccggggttgtgcgcgagcatgatcatgtcgacgtggaataccccctgcgccttgggcg 904 Query: 396 tagcttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggca 455 | || ||||| || |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 903 tggcctccgggttcaccggcaggatgcactccacgagcaccaccttgccgtgcgccggca 844 Query: 456 gcgcgtcgtag 466 ||||||||||| Sbjct: 843 gcgcgtcgtag 833
>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA, complete cds Length = 1440 Score = 212 bits (107), Expect = 8e-52 Identities = 212/247 (85%) Strand = Plus / Minus Query: 220 catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 279 ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| | Sbjct: 1156 catctacttggtgaactcgatggcccacgcgtttgcgtagatgtacgtggacttgacgcc 1097 Query: 280 ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 339 || |||||| || ||| ||||||||||||||||||||||||| ||||||||||| || || Sbjct: 1096 ggtgaacccagctcccctggccagggcctcgaactccctctcgtacctctccctgccgcc 1037 Query: 340 tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 399 |||||||||||||||||||||||||| | || ||| || ||||| | | || | || Sbjct: 1036 ggggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggcttggc 977 Query: 400 ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 459 ||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||| Sbjct: 976 ctccgggttgaccggcaggatgcactcgacgagcacgaccttgccgtgcgccggcagcgc 917 Query: 460 gtcgtag 466 ||||||| Sbjct: 916 gtcgtag 910
>gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-methyltransferase mRNA, complete cds Length = 1430 Score = 196 bits (99), Expect = 5e-47 Identities = 210/247 (85%) Strand = Plus / Minus Query: 220 catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 279 ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| | Sbjct: 1163 catctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagcc 1104 Query: 280 ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 339 |||||| || || |||||||| || ||||||||||||||||| ||||||||||| ||||| Sbjct: 1103 ggcgaagccagctcccttggcgagcgcctcgaactccctctcgtacctctccctgccacc 1044 Query: 340 tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 399 |||||||||||||||||||||||||| | || |||||| ||||| | | || | || Sbjct: 1043 ggggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggc 984 Query: 400 ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 459 ||||| | |||||||||||||||||||| || ||||||||||||||||| |||||||| Sbjct: 983 ctccgggtgcaccggcaggatgcactccaccagtaccaccttgccgtgcgctggcagcgc 924 Query: 460 gtcgtag 466 ||||||| Sbjct: 923 gtcgtag 917
>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA, complete cds Length = 1438 Score = 196 bits (99), Expect = 5e-47 Identities = 210/247 (85%) Strand = Plus / Minus Query: 220 catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 279 ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| | Sbjct: 1147 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgcc 1088 Query: 280 ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 339 || ||| ||||| ||| |||| || |||||||||||||| || ||||||||||| || || Sbjct: 1087 ggtgaagccggctcccctggcgagcgcctcgaactccctttcgtacctctccctgccgcc 1028 Query: 340 tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 399 |||||||||||||||||||||||||| | || |||||| ||||| | | || | || Sbjct: 1027 ggggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggc 968 Query: 400 ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 459 ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 967 ctccgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggcagcgc 908 Query: 460 gtcgtag 466 ||||||| Sbjct: 907 gtcgtag 901
>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA, complete cds Length = 1446 Score = 188 bits (95), Expect = 1e-44 Identities = 209/247 (84%) Strand = Plus / Minus Query: 220 catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 279 ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| | Sbjct: 1130 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgcc 1071 Query: 280 ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 339 || ||| ||||| ||| |||| || |||| |||||||||||| ||||||||||| || || Sbjct: 1070 ggtgaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgcc 1011 Query: 340 tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 399 |||||||||||||||||||||||||| | || ||| || ||||| | | || | || Sbjct: 1010 ggggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggc 951 Query: 400 ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 459 ||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||| Sbjct: 950 ctccgggttgaccggcaggatgcactcgacgagcacgaccttgccgtgcgccggcagcgc 891 Query: 460 gtcgtag 466 ||||||| Sbjct: 890 gtcgtag 884
>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA, complete cds Length = 1455 Score = 180 bits (91), Expect = 3e-42 Identities = 208/247 (84%) Strand = Plus / Minus Query: 220 catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 279 ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| | Sbjct: 1137 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgcc 1078 Query: 280 ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 339 || ||| ||||| ||| |||| || |||| |||||||||||| ||||||||||| || || Sbjct: 1077 ggtgaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgcc 1018 Query: 340 tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 399 |||||||||||||||||||||||||| | || ||| || ||||| | | || | || Sbjct: 1017 ggggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggc 958 Query: 400 ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 459 ||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||| Sbjct: 957 ctccgggttgaccggcaggatgcactggacgagcacgaccttgccgtgcgccggcagcgc 898 Query: 460 gtcgtag 466 ||||||| Sbjct: 897 gtcgtag 891
>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid O-methyltransferase mRNA, complete cds Length = 1475 Score = 172 bits (87), Expect = 7e-40 Identities = 207/247 (83%) Strand = Plus / Minus Query: 220 catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 279 ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| Sbjct: 1156 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacacc 1097 Query: 280 ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 339 || ||| ||||| ||| |||| || |||| |||||||||||| ||||||||||| || || Sbjct: 1096 ggtgaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccccc 1037 Query: 340 tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagc 399 |||||||||||||||||||||||||| | || ||| || ||||| | | || | || Sbjct: 1036 ggggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggc 977 Query: 400 ttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgc 459 ||||| |||||||||||||||||||| |||||||| |||||||||| |||||||||||| Sbjct: 976 ctccgggttgaccggcaggatgcactcgacgagcacgaccttgccgttcgccggcagcgc 917 Query: 460 gtcgtag 466 ||||||| Sbjct: 916 gtcgtag 910
>gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltransferase (OMT3) mRNA, complete cds Length = 1436 Score = 168 bits (85), Expect = 1e-38 Identities = 205/245 (83%) Strand = Plus / Minus Query: 222 tctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggagg 281 ||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| | || Sbjct: 1172 tctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagccgg 1113 Query: 282 cgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctg 341 |||| || || ||| |||| || |||||| |||||||||| ||||||||||| || |||| Sbjct: 1112 cgaagccagctcccctggcgagcgcctcgtactccctctcgtacctctccctgccgcctg 1053 Query: 342 ggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagctt 401 ||||||||||||||||||||||||| | || |||||| ||||| | | || | || | Sbjct: 1052 ggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcct 993 Query: 402 ccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgt 461 |||| || |||||||||||||||||||| ||||||||||| |||||| |||||||||| Sbjct: 992 ccgggttcaccggcaggatgcactccaccagcaccaccttaccgtgcattggcagcgcgt 933 Query: 462 cgtag 466 ||||| Sbjct: 932 cgtag 928
>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase Length = 1486 Score = 131 bits (66), Expect = 2e-27 Identities = 192/234 (82%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || |||||||||| Sbjct: 1183 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaacccggcg 1124 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| ||| | | |||||||| ||| |||| |||||| || || ||||| |||||| Sbjct: 1123 cccttggcgaggtcgtggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 1064 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||| || || | || ||| Sbjct: 1063 agcatgatcatgtcgacgtggaacacgccctgcgccttcgggacggcctcggtgttcacc 1004 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | ||||||||||| | ||||||||||||||||| Sbjct: 1003 ggcagcacgcactcgacgatgatcaccttgccgttctccggcagcgcgtcgtag 950
>gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyltransferase (COMT) gene, complete cds Length = 2012 Score = 131 bits (66), Expect = 2e-27 Identities = 192/234 (82%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || |||||||||| Sbjct: 2002 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaacccggcg 1943 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| ||| | | |||||||| ||| |||| |||||| || || ||||| |||||| Sbjct: 1942 cccttggcgaggtcgtggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 1883 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||| || || | || ||| Sbjct: 1882 agcatgatcatgtcgacgtggaacacgccctgcgccttcgggacggcctcggtgttcacc 1823 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | ||||||||||| | ||||||||||||||||| Sbjct: 1822 ggcagcacgcactcgacgacgatcaccttgccgttctccggcagcgcgtcgtag 1769
>emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caffeate o-methyltransferase (comt gene) Length = 878 Score = 123 bits (62), Expect = 5e-25 Identities = 110/126 (87%) Strand = Plus / Minus Query: 341 gggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagct 400 |||||||||||||||||||||||||| | || |||||| ||||| | | || | || Sbjct: 859 gggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcc 800 Query: 401 tccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcg 460 ||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 799 tccgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggcagcgcg 740 Query: 461 tcgtag 466 |||||| Sbjct: 739 tcgtag 734
>gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferase mRNA, partial cds Length = 604 Score = 115 bits (58), Expect = 1e-22 Identities = 109/126 (86%) Strand = Plus / Minus Query: 341 gggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagct 400 |||||||| || ||||||||||| || || | |||| | || ||||||||||| || ||| Sbjct: 590 gggttgtgtgctagcatgatcatatcgagatggaaccccccttgtgccttaggcgtggct 531 Query: 401 tccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcg 460 ||||| || ||||||| ||||||||||||||||| ||||||||||||| |||||||||| Sbjct: 530 tccgggttcaccggcaagatgcactccacgagcattaccttgccgtgcgtcggcagcgcg 471 Query: 461 tcgtag 466 |||||| Sbjct: 470 tcgtag 465
>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete cds Length = 2955 Score = 115 bits (58), Expect = 1e-22 Identities = 190/234 (81%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 2609 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2550 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || ||||||||||||||| Sbjct: 2549 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 2490 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 2489 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2430 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2429 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2376
>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete cds Length = 3282 Score = 115 bits (58), Expect = 1e-22 Identities = 190/234 (81%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 2936 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2877 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || ||||||||||||||| Sbjct: 2876 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 2817 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 2816 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2757 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2756 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2703
>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete cds Length = 2982 Score = 115 bits (58), Expect = 1e-22 Identities = 190/234 (81%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 2960 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2901 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || ||||||||||||||| Sbjct: 2900 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 2841 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 2840 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2781 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2780 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2727
>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds Length = 3190 Score = 115 bits (58), Expect = 1e-22 Identities = 190/234 (81%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 3168 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 3109 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || ||||||||||||||| Sbjct: 3108 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 3049 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 3048 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2989 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2988 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2935
>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene, complete cds Length = 2326 Score = 115 bits (58), Expect = 1e-22 Identities = 190/234 (81%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 1980 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1921 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || ||||||||||||||| Sbjct: 1920 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 1861 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 1860 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 1801 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 1800 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 1747
>emb|AJ586106.1| Festuca arundinacea partial mRNA for putative caffeate o-methyltransferase (comt gene) Length = 878 Score = 113 bits (57), Expect = 5e-22 Identities = 111/129 (86%) Strand = Plus / Minus Query: 338 cctgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttaggggta 397 ||||||||||||||||||||||||||||| | || ||| || ||||| | | || | Sbjct: 862 cctgggttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattg 803 Query: 398 gcttccggattgaccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagc 457 || ||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 802 gcctccgggttgaccggcaggatgcacttgacgagcacgaccttgccgtgcgccggcagc 743 Query: 458 gcgtcgtag 466 ||||||||| Sbjct: 742 gcgtcgtag 734
>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene, complete cds Length = 2326 Score = 109 bits (55), Expect = 8e-21 Identities = 163/199 (81%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 1980 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1921 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || ||||||||||||||| Sbjct: 1920 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 1861 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 1860 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 1801 Query: 413 ggcaggatgcactccacga 431 ||||| | |||||| |||| Sbjct: 1800 ggcagcacgcactcgacga 1782
>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete cds Length = 2676 Score = 107 bits (54), Expect = 3e-20 Identities = 189/234 (80%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 2654 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2595 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || |||||||| |||||| Sbjct: 2594 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttatgcgcg 2535 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 2534 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2475 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2474 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2421
>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene, complete cds Length = 3088 Score = 107 bits (54), Expect = 3e-20 Identities = 189/234 (80%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 3066 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 3007 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || |||||||| |||||| Sbjct: 3006 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttatgcgcg 2947 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 2946 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2887 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2886 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2833
>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene, complete cds Length = 3095 Score = 107 bits (54), Expect = 3e-20 Identities = 189/234 (80%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 3073 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 3014 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || || |||||||||||| Sbjct: 3013 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 2954 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 2953 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 2894 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2893 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2840
>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene, complete cds Length = 2074 Score = 107 bits (54), Expect = 3e-20 Identities = 189/234 (80%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 2052 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1993 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || |||||||| |||||| Sbjct: 1992 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttatgcgcg 1933 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 1932 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 1873 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 1872 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 1819
>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds Length = 2512 Score = 107 bits (54), Expect = 3e-20 Identities = 189/234 (80%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 2131 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2072 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || || |||||||||||| Sbjct: 2071 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 2012 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || |||||| ||||| ||||| ||||| || |||| |||||| Sbjct: 2011 agcatgatcatgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgacc 1952 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 1951 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 1898
>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial cds Length = 2892 Score = 101 bits (51), Expect = 2e-18 Identities = 177/219 (80%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 2888 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2829 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || ||||||||||||||||||||||||||||| Sbjct: 2828 cggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcgagcatgatcatgtcg 2769 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2768 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2709 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2708 acgacgatgaccttgccattttccggcagcgcgtcgtag 2670
>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene, complete cds Length = 3061 Score = 99.6 bits (50), Expect = 8e-18 Identities = 188/234 (80%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 3051 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2992 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || || |||||||||||| Sbjct: 2991 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 2932 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || ||| || ||||| ||||| ||||| || |||| |||||| Sbjct: 2931 agcatgatcatgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgacc 2872 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2871 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2818
>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete cds Length = 2041 Score = 99.6 bits (50), Expect = 8e-18 Identities = 188/234 (80%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| || ||| |||||| Sbjct: 2031 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1972 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 |||||||| || | |||||| | ||| |||| |||| | || || |||||||||||| Sbjct: 1971 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 1912 Query: 353 agcatgatcatgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgacc 412 |||||||||||||| | || ||| || ||||| ||||| ||||| || |||| |||||| Sbjct: 1911 agcatgatcatgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgacc 1852 Query: 413 ggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| | |||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 1851 ggcagcacgcactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 1798
>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial cds Length = 2927 Score = 97.6 bits (49), Expect = 3e-17 Identities = 181/225 (80%) Strand = Plus / Minus Query: 242 gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 301 ||||| ||||| ||||||||||| |||||||||| || ||| |||||||||||||| Sbjct: 2927 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 2868 Query: 302 agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 361 || | |||||| | ||| |||| |||| | || || ||||||||||||||||||||| Sbjct: 2867 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2808 Query: 362 atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 421 ||||| | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | | Sbjct: 2807 atgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2748 Query: 422 cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2747 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2703
>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial cds Length = 2951 Score = 97.6 bits (49), Expect = 3e-17 Identities = 181/225 (80%) Strand = Plus / Minus Query: 242 gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 301 ||||| ||||| ||||||||||| |||||||||| || ||| |||||||||||||| Sbjct: 2951 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 2892 Query: 302 agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 361 || | |||||| | ||| |||| |||| | || || ||||||||||||||||||||| Sbjct: 2891 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2832 Query: 362 atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 421 ||||| | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | | Sbjct: 2831 atgtcgacgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2772 Query: 422 cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2771 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2727
>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial cds Length = 3154 Score = 95.6 bits (48), Expect = 1e-16 Identities = 150/184 (81%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 3150 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 3091 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || ||||||||||||||||||||||||||||| Sbjct: 3090 cggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcgagcatgatcatgtcg 3031 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 3030 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2971 Query: 428 acga 431 |||| Sbjct: 2970 acga 2967
>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial cds Length = 2782 Score = 93.7 bits (47), Expect = 5e-16 Identities = 176/219 (80%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 2778 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2719 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 2718 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2659 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2658 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2599 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2598 acgacgatgaccttgccattttccggcagcgcgtcgtag 2560
>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial cds Length = 2925 Score = 93.7 bits (47), Expect = 5e-16 Identities = 176/219 (80%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 2921 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2862 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 2861 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2802 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2801 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2742 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2741 acgacgatgaccttgccattttccggcagcgcgtcgtag 2703
>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial cds Length = 2850 Score = 93.7 bits (47), Expect = 5e-16 Identities = 176/219 (80%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 2846 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2787 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 2786 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2727 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2726 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2667 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2666 acgacgatgaccttgccattttccggcagcgcgtcgtag 2628
>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial cds Length = 2782 Score = 93.7 bits (47), Expect = 5e-16 Identities = 176/219 (80%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 2778 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2719 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 2718 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2659 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2658 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2599 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2598 acgacgatgaccttgccattttccggcagcgcgtcgtag 2560
>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds Length = 2948 Score = 93.7 bits (47), Expect = 5e-16 Identities = 176/219 (80%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 2944 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2885 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 2884 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2825 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2824 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2765 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2764 acgacgatgaccttgccattttccggcagcgcgtcgtag 2726
>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial cds Length = 2748 Score = 93.7 bits (47), Expect = 5e-16 Identities = 176/219 (80%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 2744 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2685 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 2684 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2625 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || |||||| ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2624 acgtggaacacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2565 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2564 acgacgatgaccttgccattttccggcagcgcgtcgtag 2526
>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial cds Length = 2675 Score = 89.7 bits (45), Expect = 8e-15 Identities = 180/225 (80%) Strand = Plus / Minus Query: 242 gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 301 ||||| ||||| ||||||||||| |||||||||| || ||| |||||||||||||| Sbjct: 2675 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 2616 Query: 302 agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 361 || | |||||| | ||| |||| |||| | || || ||||||||||||||||||||| Sbjct: 2615 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2556 Query: 362 atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 421 ||||| | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | | Sbjct: 2555 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2496 Query: 422 cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2495 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2451
>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial cds Length = 3151 Score = 89.7 bits (45), Expect = 8e-15 Identities = 180/225 (80%) Strand = Plus / Minus Query: 242 gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 301 ||||| ||||| ||||||||||| |||||||||| || ||| |||||||||||||| Sbjct: 3151 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 3092 Query: 302 agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 361 || | |||||| | ||| |||| |||| | || || ||||||||||||||||||||| Sbjct: 3091 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 3032 Query: 362 atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 421 ||||| | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | | Sbjct: 3031 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2972 Query: 422 cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2971 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2927
>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds Length = 3146 Score = 89.7 bits (45), Expect = 8e-15 Identities = 180/225 (80%) Strand = Plus / Minus Query: 242 gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 301 ||||| ||||| ||||||||||| |||||||||| || ||| |||||||||||||| Sbjct: 3146 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 3087 Query: 302 agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 361 || | |||||| | ||| |||| |||| | || || ||||||||||||||||||||| Sbjct: 3086 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 3027 Query: 362 atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 421 ||||| | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | | Sbjct: 3026 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2967 Query: 422 cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2966 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2922
>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds Length = 3206 Score = 87.7 bits (44), Expect = 3e-14 Identities = 179/224 (79%) Strand = Plus / Minus Query: 243 cccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcca 302 |||| ||||| ||||||||||| |||||||||| || ||| |||||||||||||| | Sbjct: 3204 cccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcga 3145 Query: 303 gggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatca 362 | | |||||| | ||| |||| |||| | || || |||||||||||||||||||||| Sbjct: 3144 gctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatca 3085 Query: 363 tgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgc 422 |||| | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | || Sbjct: 3084 tgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgc 3025 Query: 423 actccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| |||| | |||||||| | ||||||||||||||||| Sbjct: 3024 actcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2981
>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial cds Length = 2757 Score = 85.7 bits (43), Expect = 1e-13 Identities = 175/219 (79%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 2753 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2694 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 2693 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2634 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2633 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2574 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2573 acgacgatgaccttgccattttccggcagcgcgtcgtag 2535
>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds Length = 3102 Score = 85.7 bits (43), Expect = 1e-13 Identities = 175/219 (79%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 3098 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 3039 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 3038 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2979 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2978 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2919 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2918 acgacgatgaccttgccattttccggcagcgcgtcgtag 2880
>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds Length = 3131 Score = 85.7 bits (43), Expect = 1e-13 Identities = 175/219 (79%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| |||||||||||||| || | Sbjct: 3127 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 3068 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 3067 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 3008 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 3007 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2948 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2947 acgacgatgaccttgccattttccggcagcgcgtcgtag 2909
>ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1425 Score = 83.8 bits (42), Expect = 5e-13 Identities = 132/162 (81%) Strand = Plus / Minus Query: 223 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 282 |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| | || Sbjct: 1189 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130 Query: 283 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 342 ||| |||||| | ||| || || |||||||||||| ||||||||| | || || || Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070 Query: 343 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 384 |||||| ||||||||||||||||| | || |||||| ||||| Sbjct: 1069 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 1028 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 411 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||||| | ||||||||| | ||||||||| |||||| ||||||||||||||||| Sbjct: 1001 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 946
>dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G09, full insert sequence Length = 1227 Score = 83.8 bits (42), Expect = 5e-13 Identities = 132/162 (81%) Strand = Plus / Minus Query: 223 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 282 |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| | || Sbjct: 987 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 928 Query: 283 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 342 ||| |||||| | ||| || || |||||||||||| ||||||||| | || || || Sbjct: 927 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 868 Query: 343 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 384 |||||| ||||||||||||||||| | || |||||| ||||| Sbjct: 867 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 826 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 411 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||||| | ||||||||| | ||||||||| |||||| ||||||||||||||||| Sbjct: 799 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 744
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 83.8 bits (42), Expect = 5e-13 Identities = 132/162 (81%) Strand = Plus / Plus Query: 223 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 282 |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| | || Sbjct: 3331696 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 3331755 Query: 283 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 342 ||| |||||| | ||| || || |||||||||||| ||||||||| | || || || Sbjct: 3331756 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 3331815 Query: 343 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 384 |||||| ||||||||||||||||| | || |||||| ||||| Sbjct: 3331816 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 3331857 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 411 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||||| | ||||||||| | ||||||||| |||||| ||||||||||||||||| Sbjct: 3331884 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 3331939
>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9) mRNA, complete cds Length = 1190 Score = 83.8 bits (42), Expect = 5e-13 Identities = 132/162 (81%) Strand = Plus / Minus Query: 223 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 282 |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| | || Sbjct: 1121 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1062 Query: 283 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 342 ||| |||||| | ||| || || |||||||||||| ||||||||| | || || || Sbjct: 1061 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1002 Query: 343 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 384 |||||| ||||||||||||||||| | || |||||| ||||| Sbjct: 1001 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 960 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 411 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||||| | ||||||||| | ||||||||| |||||| ||||||||||||||||| Sbjct: 933 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 878
>dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA for caffeic acid o-methyl transferase, partial cds Length = 1067 Score = 83.8 bits (42), Expect = 5e-13 Identities = 132/162 (81%) Strand = Plus / Minus Query: 223 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 282 |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| | || Sbjct: 807 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 748 Query: 283 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 342 ||| |||||| | ||| || || |||||||||||| ||||||||| | || || || Sbjct: 747 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 688 Query: 343 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 384 |||||| ||||||||||||||||| | || |||||| ||||| Sbjct: 687 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 646 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 411 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||||| | ||||||||| | ||||||||| |||||| ||||||||||||||||| Sbjct: 619 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 564
>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0438H08 Length = 148626 Score = 83.8 bits (42), Expect = 5e-13 Identities = 132/162 (81%) Strand = Plus / Plus Query: 223 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 282 |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| | || Sbjct: 109263 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 109322 Query: 283 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 342 ||| |||||| | ||| || || |||||||||||| ||||||||| | || || || Sbjct: 109323 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 109382 Query: 343 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 384 |||||| ||||||||||||||||| | || |||||| ||||| Sbjct: 109383 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 109424 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 411 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||||| | ||||||||| | ||||||||| |||||| ||||||||||||||||| Sbjct: 109451 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 109506
>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full insert sequence Length = 1425 Score = 83.8 bits (42), Expect = 5e-13 Identities = 132/162 (81%) Strand = Plus / Minus Query: 223 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 282 |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| | || Sbjct: 1189 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130 Query: 283 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 342 ||| |||||| | ||| || || |||||||||||| ||||||||| | || || || Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070 Query: 343 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 384 |||||| ||||||||||||||||| | || |||||| ||||| Sbjct: 1069 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 1028 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 411 ccggcaggatgcactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||||| | ||||||||| | ||||||||| |||||| ||||||||||||||||| Sbjct: 1001 ccggcagcacgcactccaccaccaccaccttcccgtgctccggcagcgcgtcgtag 946
>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds Length = 3111 Score = 81.8 bits (41), Expect = 2e-12 Identities = 179/225 (79%) Strand = Plus / Minus Query: 242 gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 301 ||||| ||||| ||||||||||| |||||||||| || ||| ||||||||||| || Sbjct: 3111 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcg 3052 Query: 302 agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 361 || | |||||| | ||| |||| |||| | || || ||||||||||||||||||||| Sbjct: 3051 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2992 Query: 362 atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 421 ||||| | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | | Sbjct: 2991 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2932 Query: 422 cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2931 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2887
>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds Length = 3073 Score = 81.8 bits (41), Expect = 2e-12 Identities = 179/225 (79%) Strand = Plus / Minus Query: 242 gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 301 ||||| ||||| ||||||||||| |||||||||| || ||| ||||||||||| || Sbjct: 3073 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcg 3014 Query: 302 agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 361 || | |||||| | ||| |||| |||| | || || ||||||||||||||||||||| Sbjct: 3013 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2954 Query: 362 atgtcaaggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatg 421 ||||| | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | | Sbjct: 2953 atgtcgacgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacg 2894 Query: 422 cactccacgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 ||||| |||| | |||||||| | ||||||||||||||||| Sbjct: 2893 cactcgacgacgatgaccttgccattttccggcagcgcgtcgtag 2849
>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial cds Length = 2643 Score = 77.8 bits (39), Expect = 3e-11 Identities = 174/219 (79%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| ||||||||||| || || | Sbjct: 2639 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcgagctcg 2580 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 2579 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2520 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2519 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2460 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2459 acgacgatgaccttgccattttccggcagcgcgtcgtag 2421
>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial cds Length = 2639 Score = 77.8 bits (39), Expect = 3e-11 Identities = 174/219 (79%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| ||||||||||| || || | Sbjct: 2635 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcgagctcg 2576 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 2575 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2516 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2515 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2456 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2455 acgacgatgaccttgccattttccggcagcgcgtcgtag 2417
>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds Length = 3105 Score = 77.8 bits (39), Expect = 3e-11 Identities = 174/219 (79%) Strand = Plus / Minus Query: 248 gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 307 ||||| ||||||||||| |||||||||| || ||| ||||||||||| || || | Sbjct: 3101 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcgagctcg 3042 Query: 308 tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 367 |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| Sbjct: 3041 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2982 Query: 368 aggttgaacacaccctgtgccttaggggtagcttccggattgaccggcaggatgcactcc 427 | || ||| || ||||| ||||| ||||| || |||| ||||||||||| | |||||| Sbjct: 2981 acgtggaagacgccctgcgccttgggggtggcctccgtgttgaccggcagcacgcactcg 2922 Query: 428 acgagcaccaccttgccgtgcgccggcagcgcgtcgtag 466 |||| | |||||||| | ||||||||||||||||| Sbjct: 2921 acgacgatgaccttgccattttccggcagcgcgtcgtag 2883
>gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase gene, complete cds Length = 3312 Score = 67.9 bits (34), Expect = 3e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| | ||| || ||| Sbjct: 2769 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccagagaagccagcg 2710 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 ||||||| ||| | |||||||| ||| |||| |||||| || || ||||| |||||| Sbjct: 2709 gccttggcgaggtcacggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 2650 Query: 353 agcatgatcatgtc 366 |||||||||||||| Sbjct: 2649 agcatgatcatgtc 2636
>gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA, complete cds Length = 1458 Score = 67.9 bits (34), Expect = 3e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 233 aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 292 |||||||| ||||| ||||| ||||||||||| |||||||||| | ||| || ||| Sbjct: 1188 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccagagaagccagcg 1129 Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 ||||||| ||| | |||||||| ||| |||| |||||| || || ||||| |||||| Sbjct: 1128 gccttggcgaggtcacggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 1069 Query: 353 agcatgatcatgtc 366 |||||||||||||| Sbjct: 1068 agcatgatcatgtc 1055
>gb|AY098514.1| Ananas comosus caffeic acid O-methyltransferase mRNA, partial cds Length = 460 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Minus Query: 341 gggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 384 ||||||||||| |||||||||||||| | || |||||| ||||| Sbjct: 108 gggttgtgcgccagcatgatcatgtcgacgtggaacacgccctg 65
>gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full insert mRNA sequence Length = 1308 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 410 accggcaggatgcactccacgagcaccaccttgcc 444 ||||||||||||| |||||||| ||||||||||| Sbjct: 994 accggcaggatgccctccacgatgaccaccttgcc 960
>emb|AL138831.12| Human DNA sequence from clone RP3-406P24 on chromosome 6 Contains a thioredoxin-like pseudogene, the gene for thioredoxin-like 2 (TXNL2), a novel gene and the 5' end of the gene for serine/threonine-protein kinase PRP4 homolog (PRP4),(PR4H, PRP4H, KIAA0536). Contains 2 CpG islands, complete sequence Length = 49600 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 177 ggagcagcaatgagcatgcaag 198 |||||||||||||||||||||| Sbjct: 20280 ggagcagcaatgagcatgcaag 20301
>emb|AJ632203.2| Streptomyces antibioticus oviedomycin biosynthetic gene cluster, strain ATCC 11891 Length = 24720 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 442 gccgtgcgccggcagcgcgtcg 463 |||||||||||||||||||||| Sbjct: 19739 gccgtgcgccggcagcgcgtcg 19760
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 438 ccttgccgtgcgccggcagcg 458 ||||||||||||||||||||| Sbjct: 3430054 ccttgccgtgcgccggcagcg 3430034
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 291 cgcccttggccagggcctcga 311 ||||||||||||||||||||| Sbjct: 4318826 cgcccttggccagggcctcga 4318846 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 442 gccgtgcgccggcagcgcgtc 462 ||||||||||||||||||||| Sbjct: 3816881 gccgtgcgccggcagcgcgtc 3816901
>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome Length = 2256640 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 428 acgagcaccaccttgccgtgc 448 ||||||||||||||||||||| Sbjct: 1436360 acgagcaccaccttgccgtgc 1436380
>emb|AL806522.4| Mouse DNA sequence from clone RP23-167H2 on chromosome 2, complete sequence Length = 189104 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 aaattaagggaaaacataggg 140 ||||||||||||||||||||| Sbjct: 170272 aaattaagggaaaacataggg 170252
>gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome Length = 569630 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 523998 catcatatataattaatgca 524017 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 455061 catcatatataattaatgca 455080
>gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mitochondrion, complete genome Length = 701046 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 643780 catcatatataattaatgca 643799
>gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion, complete genome Length = 569553 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 556187 catcatatataattaatgca 556206
>gb|AY794816.1| Galearia filiformis tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 1013 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 aattagaaattggaatgatt 107 |||||||||||||||||||| Sbjct: 781 aattagaaattggaatgatt 800
>gb|AY794673.1| Omphalea palmata tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 1088 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 aattagaaattggaatgatt 107 |||||||||||||||||||| Sbjct: 817 aattagaaattggaatgatt 836
>gb|AY794672.1| Omphalea diandra tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 1077 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 aattagaaattggaatgatt 107 |||||||||||||||||||| Sbjct: 811 aattagaaattggaatgatt 830
>gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic acid O-methyltransferase mRNA, complete cds Length = 1408 Score = 40.1 bits (20), Expect = 6.3 Identities = 56/68 (82%) Strand = Plus / Minus Query: 293 cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 352 ||||||||||| ||||| ||||| ||||| |||||| | ||||||||||| || || Sbjct: 1093 cccttggccagagcctcaaactctttctcagtcctctctttgccacctgggttatgagcc 1034 Query: 353 agcatgat 360 |||||||| Sbjct: 1033 agcatgat 1026
>gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion, complete genome Length = 535825 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 54575 catcatatataattaatgca 54594
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome Length = 3928089 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 397 agcttccggattgaccggca 416 |||||||||||||||||||| Sbjct: 2977957 agcttccggattgaccggca 2977976
>gb|AC138448.9| Medicago truncatula clone mth2-11n13, complete sequence Length = 112155 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 catatggaatggaccaatgg 81 |||||||||||||||||||| Sbjct: 46376 catatggaatggaccaatgg 46357 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 catatggaatggaccaatgg 81 |||||||||||||||||||| Sbjct: 39072 catatggaatggaccaatgg 39053 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 catatggaatggaccaatgg 81 |||||||||||||||||||| Sbjct: 32824 catatggaatggaccaatgg 32805
>emb|Z83001.1|HSG0453 Human DNA sequence from clone XX-G0453 on chromosome 11, complete sequence Length = 32246 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 107 tcaaaggatgcaaaaattaa 126 |||||||||||||||||||| Sbjct: 26735 tcaaaggatgcaaaaattaa 26716
>emb|AL136373.21| Human DNA sequence from clone RP11-49P4 on chromosome 1p32.2-33 Contains two novel genes (FLJ40412, FLJ32011), the MKNK1 gene for MAP kinase-interacting serine/threonine kinase 1, the gene for MOB3C protein (MOB3C) and the 3' end of the ATPAF1 gene for ATP synthase mitochondrial F1 complex assembly factor 1, complete sequence Length = 121112 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 326 ctctccctaccacctgggtt 345 |||||||||||||||||||| Sbjct: 90353 ctctccctaccacctgggtt 90372
>emb|AL049745.9|HSJ654H19 Human DNA sequence from clone RP4-654H19 on chromosome 1p31.1-33 Contains the 5' end of the gene for likely ortholog of mouse Gli-similar 1 Kruppel-like zinc finger (Glia1) (FLJ36155), a novel gene (FLJ10407), a ribosomal protein L37 (RPL37) pseudogene and a CpG island, complete sequence Length = 117493 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 atggcacaacaattagaaat 97 |||||||||||||||||||| Sbjct: 77238 atggcacaacaattagaaat 77257
>gb|AC010282.6| Homo sapiens chromosome 5 clone CTC-555I19, complete sequence Length = 191131 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 84 caacaattagaaattggaat 103 |||||||||||||||||||| Sbjct: 85981 caacaattagaaattggaat 86000
>emb|Z00026.1|MIZMATP1 Maize mitochondrial gene for F1-ATPase alpha-subunit Length = 1620 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 907 catcatatataattaatgca 888
>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces hansenii Length = 2051428 Score = 40.1 bits (20), Expect = 6.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 8 atgattgcatcatatataattaatgcaa 35 ||||| ||||||||||||||| |||||| Sbjct: 1986287 atgatggcatcatatataattcatgcaa 1986260
>emb|AJ278690.1|SBI278690 Sorghum bicolor partial mitochondrial mRNA for F0-F1 ATPase alpha subunit (atpA gene), cultivar 2077A Length = 1324 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 784 catcatatataattaatgca 765
>emb|AJ278689.1|SBI278689 Sorghum bicolor partial mitochondrial mRNA for F0-F1 ATPase alpha subunit (atpA gene), cultivar CS3541 Length = 1324 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 784 catcatatataattaatgca 765
>emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chromosome 11 Contains a novel pseudogene, complete sequence Length = 203319 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 107 tcaaaggatgcaaaaattaa 126 |||||||||||||||||||| Sbjct: 147829 tcaaaggatgcaaaaattaa 147810
>gb|AC011478.3| Homo sapiens chromosome 19 clone CTC-565M22, complete sequence Length = 100147 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 taatgcaacatttaagagaa 47 |||||||||||||||||||| Sbjct: 60624 taatgcaacatttaagagaa 60643
>gb|AE012241.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 149 of 460 of the complete genome Length = 10029 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 426 ccacgagcaccaccttgccg 445 |||||||||||||||||||| Sbjct: 2604 ccacgagcaccaccttgccg 2585
>gb|AY094283.1| Zea mays cultivar F_7 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 320 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304
>gb|AY094282.1| Zea mays cultivar D_9 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 337 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 290 aactcgatggcccaggcgttggcgtagatgta 321
>gb|AY094281.1| Zea mays cultivar D_6 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 321 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 274 aactcgatggcccaggcgttggcgtagatgta 305
>gb|AY094280.1| Zea mays cultivar F_1 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 320 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304
>gb|AY094279.1| Zea mays cultivar Mo17 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 337 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 290 aactcgatggcccaggcgttggcgtagatgta 321
>gb|AY094276.1| Zea mays cultivar 684 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 328 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 281 aactcgatggcccaggcgttggcgtagatgta 312
>gb|AY094275.1| Zea mays cultivar I_1 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 304 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 257 aactcgatggcccaggcgttggcgtagatgta 288
>gb|AY094274.1| Zea mays cultivar F_2 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 286 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 239 aactcgatggcccaggcgttggcgtagatgta 270
>gb|AY094273.1| Zea mays cultivar G_1 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 308 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 261 aactcgatggcccaggcgttggcgtagatgta 292
>gb|AY094271.1| Zea mays cultivar F_3 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 296 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 249 aactcgatggcccaggcgttggcgtagatgta 280
>gb|AY094270.1| Zea mays cultivar F_5 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 308 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 261 aactcgatggcccaggcgttggcgtagatgta 292
>gb|AY094269.1| Zea mays cultivar H_5 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 320 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304
>gb|AY094268.1| Zea mays cultivar H_3 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 320 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304
>gb|AY094267.1| Zea mays cultivar J40 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 307 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 260 aactcgatggcccaggcgttggcgtagatgta 291
>gb|AY094266.1| Zea mays cultivar 647 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 345 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 298 aactcgatggcccaggcgttggcgtagatgta 329
>gb|AY094265.1| Zea mays cultivar B_1 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 324 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 277 aactcgatggcccaggcgttggcgtagatgta 308
>gb|AY094264.1| Zea mays cultivar F_6 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 324 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 277 aactcgatggcccaggcgttggcgtagatgta 308
>gb|AY094263.1| Zea mays cultivar C_5 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 324 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 277 aactcgatggcccaggcgttggcgtagatgta 308
>gb|AY094262.1| Zea mays cultivar H_1 caffeic acid 3-O-methyltransferase, 3' UTR and partial cds Length = 322 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 233 aactcgattgcccatgcgttagcgtagatgta 264 |||||||| ||||| ||||| ||||||||||| Sbjct: 275 aactcgatggcccaggcgttggcgtagatgta 306
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 288 cggcgcccttggccagggcctcga 311 ||||||| |||||||||||||||| Sbjct: 1740172 cggcgccattggccagggcctcga 1740195
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 426 ccacgagcaccaccttgccg 445 |||||||||||||||||||| Sbjct: 3396843 ccacgagcaccaccttgccg 3396862
>ref|XM_395084.2| PREDICTED: Apis mellifera similar to CG5811-PA (LOC411614), mRNA Length = 1281 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 gaccaatggcacaacaatta 92 |||||||||||||||||||| Sbjct: 1214 gaccaatggcacaacaatta 1233
>gb|AE004912.1| Pseudomonas aeruginosa PAO1, section 473 of 529 of the complete genome Length = 12498 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 cgcccttggccagggcctcg 310 |||||||||||||||||||| Sbjct: 5666 cgcccttggccagggcctcg 5685
>gb|AY124521.1| Luzula acuminata ATPase F1 alpha subunit (atp1) gene, partial cds; mitochondrial gene for mitochondrial product Length = 1235 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 707 catcatatataattaatgca 688
>gb|AF130358.2|AF130358 Homo sapiens chromosome 21q11.2 PAC 90B5, complete sequence Length = 197778 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 caaaaattaagggaaaacat 136 |||||||||||||||||||| Sbjct: 40577 caaaaattaagggaaaacat 40596
>emb|AL929026.10| Mouse DNA sequence from clone RP23-332K7 on chromosome 2, complete sequence Length = 124244 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 gtaagtggccttgatggagg 281 |||||||||||||||||||| Sbjct: 64001 gtaagtggccttgatggagg 63982
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 294 ccttggccagggcctcgaac 313 |||||||||||||||||||| Sbjct: 4157398 ccttggccagggcctcgaac 4157417
>gb|AF154918.1|AF154918 Ocimum basilicum caffeic acid O-methyltransferase (COMT2) mRNA, complete cds Length = 1187 Score = 40.1 bits (20), Expect = 6.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 325 cctctccctaccacctgggttgtgcgcgagcatgat 360 ||||||| | |||||||||||||| || |||||||| Sbjct: 995 cctctccttgccacctgggttgtgagccagcatgat 960
>gb|AC006556.3|AC006556 Homo sapiens, clone hRPK.37_A_1, complete sequence Length = 156833 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 caaaaattaagggaaaacat 136 |||||||||||||||||||| Sbjct: 86222 caaaaattaagggaaaacat 86203
>emb|AL132709.5|CNS01DTB Human chromosome 14 DNA sequence BAC R-909M7 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 200540 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 atatataattaatgcaacatttaa 42 ||||||||||||||||| |||||| Sbjct: 154212 atatataattaatgcaatatttaa 154189
>dbj|AP001660.1| Homo sapiens genomic DNA, chromosome 21q, section 4/105 Length = 340000 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 caaaaattaagggaaaacat 136 |||||||||||||||||||| Sbjct: 255530 caaaaattaagggaaaacat 255549
>gb|M16222.1|MZEMTATP Maize mitochondrial ATP-alpha gene encoding F1-ATPase alpha subunit, complete cds Length = 1742 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 catcatatataattaatgca 34 |||||||||||||||||||| Sbjct: 879 catcatatataattaatgca 860
>emb|AL078615.2|HS98L15 Homo sapiens chromosome 21 PAC RPCIP704L1598Q2, complete sequence Length = 116189 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 caaaaattaagggaaaacat 136 |||||||||||||||||||| Sbjct: 66964 caaaaattaagggaaaacat 66983 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,075,941 Number of Sequences: 3902068 Number of extensions: 4075941 Number of successful extensions: 85704 Number of sequences better than 10.0: 121 Number of HSP's better than 10.0 without gapping: 121 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 85030 Number of HSP's gapped (non-prelim): 595 length of query: 466 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 444 effective length of database: 17,147,199,772 effective search space: 7613356698768 effective search space used: 7613356698768 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
