>gb|AY968589.1| Triticum aestivum ice recrystallization inhibition protein 2
            precursor, mRNA, complete cds
          Length = 1596

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 258  agatcactaacctccagttacgattttgtt 287
            ||||||||||||||||||||||| ||||||
Sbjct: 1257 agatcactaacctccagttacgactttgtt 1228

>dbj|AP003604.1| Nostoc sp. PCC 7120 plasmid pCC7120delta DNA, complete sequence
          Length = 55414

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 222   atctgatacttgcagatggaa 242
             |||||||||||||||||||||
Sbjct: 33552 atctgatacttgcagatggaa 33572

>emb|AJ235271.1|RPXX02 Rickettsia prowazekii strain Madrid E, complete genome; segment 2/4
          Length = 312430

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 8    ttaacactaatattacaagt 27
            ||||||||||||||||||||
Sbjct: 6254 ttaacactaatattacaagt 6273

>gb|AC116331.2| Homo sapiens chromosome 5 clone CTD-2037A14, complete sequence
          Length = 105259

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 157   agttcagactagctagagaa 176
             ||||||||||||||||||||
Sbjct: 16455 agttcagactagctagagaa 16436

>emb|AL928628.9| Zebrafish DNA sequence from clone DKEY-5G18 in linkage group 7,
             complete sequence
          Length = 229942

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 62    aaatactatgctaaaaaagcagta 85
             |||||||||||||||||| |||||
Sbjct: 49149 aaatactatgctaaaaaaacagta 49172


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,317,702
Number of Sequences: 3902068
Number of extensions: 2317702
Number of successful extensions: 39920
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39914
Number of HSP's gapped (non-prelim): 6
length of query: 296
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 274
effective length of database: 17,147,199,772
effective search space: 4698332737528
effective search space used: 4698332737528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)