ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart48e11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB210286.1| Sus scrofa TLR6, TLR1, TLR10 genes for Toll-like... 42 0.27
2gb|AC122110.4| Mus Musculus Strain C57BL6/J Chromosome 2 BAC, RP... 40 1.0
3gb|AC122360.4| Mus musculus BAC clone RP23-428P21 from chromosom... 40 1.0
4gb|AC161382.4| Mus musculus BAC clone RP23-25A17 from chromosome... 38 4.1
5gb|AC104856.19| Mus musculus chromosome 5, clone RP23-53G23, com... 38 4.1
6gb|AC105968.14| Mus musculus chromosome 18, clone RP23-265P4, co... 38 4.1
7ref|XM_387486.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 38 4.1
8gb|AC132351.3| Mus musculus BAC clone RP24-95F24 from chromosome... 38 4.1
9gb|AC125146.3| Mus musculus BAC clone RP24-348B1 from chromosome... 38 4.1
10emb|AL139191.15| Human DNA sequence from clone RP3-465M14 on chr... 38 4.1
11gb|AC158351.4| Mus musculus chromosome 8, clone RP24-274N3, comp... 38 4.1
12emb|AL592465.8| Mouse DNA sequence from clone RP23-36C4 on chrom... 38 4.1
13gb|AF509340.1| Gibberella zeae transcription factor Fst12 (FST12... 38 4.1
14gb|AC068273.5| Homo sapiens BAC clone RP11-89O10 from 2, complet... 38 4.1
15gb|AC007375.6|AC007375 Homo sapiens chromosome 14 clone RP11-463... 38 4.1
16gb|AC116747.10| Mus musculus chromosome 8, clone RP23-80O20, com... 38 4.1
17gb|AC140213.2| Mus musculus BAC clone RP23-270L5 from 7, complet... 38 4.1
18emb|AJ240691.1|GGA240691 Gallus gallus DNA for LEI0344 SSCP marker 38 4.1
19emb|AL731700.12| Mouse DNA sequence from clone RP23-239G1 on chr... 38 4.1
20emb|AL929065.4| Mouse DNA sequence from clone RP23-270H4 on chro... 38 4.1

>dbj|AB210286.1| Sus scrofa TLR6, TLR1, TLR10 genes for Toll-like receptor 6, Toll-like
              receptor 1, Toll-like receptor 10, complete cds
          Length = 173804

 Score = 42.1 bits (21), Expect = 0.27
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1      gcccatcaccccgcattacta 21
              |||||||||||||||||||||
Sbjct: 173157 gcccatcaccccgcattacta 173137



to top

>gb|AC122110.4| Mus Musculus Strain C57BL6/J Chromosome 2 BAC, RP23-319K8, Complete
             Sequence, complete sequence
          Length = 179550

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 53    cttcctgatctctgccccttgctg 76
             |||||| |||||||||||||||||
Sbjct: 93840 cttcctcatctctgccccttgctg 93863



to top

>gb|AC122360.4| Mus musculus BAC clone RP23-428P21 from chromosome 10, complete
             sequence
          Length = 210757

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    ctctgccccttgctggttgc 81
             ||||||||||||||||||||
Sbjct: 79090 ctctgccccttgctggttgc 79071



to top

>gb|AC161382.4| Mus musculus BAC clone RP23-25A17 from chromosome 9, complete sequence
          Length = 169123

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 62    ctctgccccttgctggttgccta 84
             |||||||||||||||| ||||||
Sbjct: 33048 ctctgccccttgctggatgccta 33026



to top

>gb|AC104856.19| Mus musculus chromosome 5, clone RP23-53G23, complete sequence
          Length = 169800

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 63     tctgccccttgctggttgc 81
              |||||||||||||||||||
Sbjct: 127040 tctgccccttgctggttgc 127058



to top

>gb|AC105968.14| Mus musculus chromosome 18, clone RP23-265P4, complete sequence
          Length = 210819

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     gcataccttcctgatctct 65
              |||||||||||||||||||
Sbjct: 161538 gcataccttcctgatctct 161520



to top

>ref|XM_387486.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07310.1)
           partial mRNA
          Length = 2088

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 53  cttcctgatctctgcccct 71
           |||||||||||||||||||
Sbjct: 126 cttcctgatctctgcccct 144



to top

>gb|AC132351.3| Mus musculus BAC clone RP24-95F24 from chromosome 18, complete sequence
          Length = 186726

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    gcataccttcctgatctct 65
             |||||||||||||||||||
Sbjct: 56578 gcataccttcctgatctct 56560



to top

>gb|AC125146.3| Mus musculus BAC clone RP24-348B1 from chromosome 2, complete sequence
          Length = 212563

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 62     ctctgccccttgctggttg 80
              |||||||||||||||||||
Sbjct: 165832 ctctgccccttgctggttg 165814



to top

>emb|AL139191.15| Human DNA sequence from clone RP3-465M14 on chromosome 6q22.33-23.3
            Contains the 5' end of the PREP gene for prolyl
            endopeptidase and a CpG island, complete sequence
          Length = 127973

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 62   ctctgccccttgctggttg 80
            |||||||||||||||||||
Sbjct: 6905 ctctgccccttgctggttg 6887



to top

>gb|AC158351.4| Mus musculus chromosome 8, clone RP24-274N3, complete sequence
          Length = 167820

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 62     ctctgccccttgctggttg 80
              |||||||||||||||||||
Sbjct: 103052 ctctgccccttgctggttg 103034



to top

>emb|AL592465.8| Mouse DNA sequence from clone RP23-36C4 on chromosome 11 Contains the
              Tbx4 gene for T-box 4, a ribosomal protein L21 (Rpl21)
              pseudogene and the 3' end of the Brip1 gene for BRCA1
              interacting protein C-terminal helicase 1, complete
              sequence
          Length = 238358

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 64     ctgccccttgctggttgcc 82
              |||||||||||||||||||
Sbjct: 209722 ctgccccttgctggttgcc 209704



to top

>gb|AF509340.1| Gibberella zeae transcription factor Fst12 (FST12) gene, complete
           cds
          Length = 2641

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 53  cttcctgatctctgcccct 71
           |||||||||||||||||||
Sbjct: 464 cttcctgatctctgcccct 482



to top

>gb|AC068273.5| Homo sapiens BAC clone RP11-89O10 from 2, complete sequence
          Length = 181016

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 61     tctctgccccttgctggtt 79
              |||||||||||||||||||
Sbjct: 148574 tctctgccccttgctggtt 148592



to top

>gb|AC007375.6|AC007375 Homo sapiens chromosome 14 clone RP11-463C8 containing POMT2 gene,
             partial cds; and unknown genes, complete sequence
          Length = 180331

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 53    cttcctgatctctgcccct 71
             |||||||||||||||||||
Sbjct: 89113 cttcctgatctctgcccct 89131



to top

>gb|AC116747.10| Mus musculus chromosome 8, clone RP23-80O20, complete sequence
          Length = 201313

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 62     ctctgccccttgctggttg 80
              |||||||||||||||||||
Sbjct: 164314 ctctgccccttgctggttg 164332



to top

>gb|AC140213.2| Mus musculus BAC clone RP23-270L5 from 7, complete sequence
          Length = 195922

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    cttcctgatctctgcccct 71
             |||||||||||||||||||
Sbjct: 86554 cttcctgatctctgcccct 86536



to top

>emb|AJ240691.1|GGA240691 Gallus gallus DNA for LEI0344 SSCP marker
          Length = 387

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 62  ctctgccccttgctggttg 80
           |||||||||||||||||||
Sbjct: 117 ctctgccccttgctggttg 99



to top

>emb|AL731700.12| Mouse DNA sequence from clone RP23-239G1 on chromosome 2, complete
             sequence
          Length = 187667

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 62    ctctgccccttgctggttg 80
             |||||||||||||||||||
Sbjct: 41750 ctctgccccttgctggttg 41768



to top

>emb|AL929065.4| Mouse DNA sequence from clone RP23-270H4 on chromosome 2, complete
              sequence
          Length = 173846

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 62     ctctgccccttgctggttg 80
              |||||||||||||||||||
Sbjct: 131900 ctctgccccttgctggttg 131918


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 511,584
Number of Sequences: 3902068
Number of extensions: 511584
Number of successful extensions: 36971
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36936
Number of HSP's gapped (non-prelim): 35
length of query: 95
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 74
effective length of database: 17,151,101,840
effective search space: 1269181536160
effective search space used: 1269181536160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top