>gb|AC125245.4| Homo sapiens BAC clone RP11-236P13 from 4, complete sequence
          Length = 135923

 Score = 40.1 bits (20), Expect = 0.74
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 4      gagggaaacatggagcatga 23
              ||||||||||||||||||||
Sbjct: 128994 gagggaaacatggagcatga 129013

>gb|AC112227.4| Homo sapiens BAC clone RP13-552G12 from 4, complete sequence
          Length = 151609

 Score = 40.1 bits (20), Expect = 0.74
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 4      gagggaaacatggagcatga 23
              ||||||||||||||||||||
Sbjct: 110491 gagggaaacatggagcatga 110510

>emb|AL645467.13| Mouse DNA sequence from clone RP23-131H22 on chromosome X, complete
             sequence
          Length = 210415

 Score = 40.1 bits (20), Expect = 0.74
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     aagagggaaacatggagcat 21
             ||||||||||||||||||||
Sbjct: 97066 aagagggaaacatggagcat 97047

>ref|XM_639095.1| Dictyostelium discoideum hypothetical protein (DDB0185183), partial
           mRNA
          Length = 543

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 55  caaaagctcatgcagatac 73
           |||||||||||||||||||
Sbjct: 420 caaaagctcatgcagatac 438

>gb|AC116957.2| Dictyostelium discoideum chromosome 2 map 1685067-2090751 strain AX4,
             complete sequence
          Length = 405682

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    caaaagctcatgcagatac 73
             |||||||||||||||||||
Sbjct: 77531 caaaagctcatgcagatac 77549

>gb|AC162526.3| Mus musculus BAC clone RP23-50I19 from chromosome 13, complete sequence
          Length = 219418

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     gacacagggcaaaagctca 64
              |||||||||||||||||||
Sbjct: 177496 gacacagggcaaaagctca 177514


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 607,729
Number of Sequences: 3902068
Number of extensions: 607729
Number of successful extensions: 41578
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41564
Number of HSP's gapped (non-prelim): 14
length of query: 73
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 52
effective length of database: 17,151,101,840
effective search space: 891857295680
effective search space used: 891857295680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)