>gb|AC098586.3| Homo sapiens BAC clone RP11-109F18 from 4, complete sequence
          Length = 150172

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 3     aaactgaaaaatctgctctttc 24
             ||||||||||||||||||||||
Sbjct: 45452 aaactgaaaaatctgctctttc 45473

>gb|AC125156.3| Mus musculus BAC clone RP24-386H5 from chromosome 18, complete sequence
          Length = 189554

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 133   ttttttcttatacacgtgctg 153
             |||||||||||||||||||||
Sbjct: 78334 ttttttcttatacacgtgctg 78354

>ref|XM_749248.1| Aspergillus fumigatus Af293 hypothetical protein (Afu3g12800) partial
            mRNA
          Length = 2139

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 270  gctccaggcccttctccattctcaccgtt 298
            ||||||| ||| |||||||||||||||||
Sbjct: 1466 gctccagacccgtctccattctcaccgtt 1438

>emb|AL596276.6| Human DNA sequence from clone RP11-115A15 on chromosome 1 Contains a
              heterogeneous nuclear ribonucleoprotein A1 (HNRPA1)
              pseudogene, a ubiquitin-conjugating enzyme E2 variant 1
              (UBE2V1) pseudogene and a cytochrome c oxidase subunit V1a
              polypeptide 1 (COX6A1) pseudogene, complete sequence
          Length = 129398

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 374    gtccatctgctcattcatggcagag 398
              |||||||||||||||| ||||||||
Sbjct: 127540 gtccatctgctcattcttggcagag 127564

>emb|AL136234.12| Human DNA sequence from clone RP5-933B4 on chromosome 1p22.3-31.1
           Contains a novel gene and the 5' end of a novel gene,
           complete sequence
          Length = 119481

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 374 gtccatctgctcattcatggcagag 398
           |||||||||||||||| ||||||||
Sbjct: 142 gtccatctgctcattcttggcagag 166

>gb|AY667337.1| Ciona intestinalis isolate Japan 4 forkhead gene, partial cds
          Length = 4406

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 67   ggtagaaaatataagtaact 86
            ||||||||||||||||||||
Sbjct: 2968 ggtagaaaatataagtaact 2949

>gb|AC167468.2| Mus musculus BAC clone RP23-163J2 from chromosome 10, complete sequence
          Length = 219954

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 190   attaacaatgcatagataat 209
             ||||||||||||||||||||
Sbjct: 84027 attaacaatgcatagataat 84046

>gb|AC125348.3| Mus musculus BAC clone RP23-377H20 from chromosome 7, complete sequence
          Length = 188610

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 387    ttcatggcagagtctgccag 406
              ||||||||||||||||||||
Sbjct: 167992 ttcatggcagagtctgccag 167973

>gb|AC102432.9| Mus musculus chromosome 19, clone RP24-114A21, complete sequence
          Length = 199240

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    gctcttgtcttggaagggac 461
              ||||||||||||||||||||
Sbjct: 171558 gctcttgtcttggaagggac 171539

>emb|AL606463.6| Human DNA sequence from clone RP11-485D21 on chromosome 1 Contains the 5'
              end of a novel gene, complete sequence
          Length = 159304

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 64     acaggtagaaaatataagta 83
              ||||||||||||||||||||
Sbjct: 139511 acaggtagaaaatataagta 139492

>emb|AL449223.7| Human DNA sequence from clone RP11-74N20 on chromosome 1 Contains the
             5' end of the NMNAT2 gene for nicotinamide nucleotide
             adenylyltransferase 2, a novel transcript, the 5' end of
             the C1orf16 gene for chromosome 1 open reading frame 16
             and a CpG island, complete sequence
          Length = 171467

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 420   gctgagtctgctgctggctg 439
             ||||||||||||||||||||
Sbjct: 66608 gctgagtctgctgctggctg 66627

>emb|AL445437.4| Human DNA sequence from clone RP11-60A14 on chromosome 1 Contains STSs
             and GSSs, complete sequence
          Length = 102094

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   gtgaaccacacagatatcta 127
             ||||||||||||||||||||
Sbjct: 48667 gtgaaccacacagatatcta 48686

>emb|AL359853.18| Human DNA sequence from clone RP11-12M5 on chromosome 1 Contains five
             novel genes and a CpG island, complete sequence
          Length = 173031

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 272   tccaggcccttctccattct 291
             ||||||||||||||||||||
Sbjct: 81052 tccaggcccttctccattct 81033

>gb|AC162918.3| Mus musculus BAC clone RP23-370K14 from chromosome 10, complete
             sequence
          Length = 165624

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   attaacaatgcatagataat 209
             ||||||||||||||||||||
Sbjct: 57419 attaacaatgcatagataat 57400

>gb|AF372979.1| Mus musculus P locus fat-associated ATPase (Atp10a) gene, exons 2
             through 21 and partial cds
          Length = 129459

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 387   ttcatggcagagtctgccag 406
             ||||||||||||||||||||
Sbjct: 22658 ttcatggcagagtctgccag 22677

>emb|BX813308.4| Mouse DNA sequence from clone RP23-34G12 on chromosome 2, complete
              sequence
          Length = 133963

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      tgaaaaatctgctctttcaa 26
              ||||||||||||||||||||
Sbjct: 112464 tgaaaaatctgctctttcaa 112445

>dbj|AP002348.3| Homo sapiens genomic DNA, chromosome 11q, clone:CTD-2528N2, complete
              sequences
          Length = 208600

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 106    aagtgaaccacacagatatc 125
              ||||||||||||||||||||
Sbjct: 164085 aagtgaaccacacagatatc 164066

>gb|AC134330.3| Mus musculus BAC clone RP24-311K19 from 7, complete sequence
          Length = 142053

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 387  ttcatggcagagtctgccag 406
            ||||||||||||||||||||
Sbjct: 1289 ttcatggcagagtctgccag 1270


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,599,078
Number of Sequences: 3902068
Number of extensions: 4599078
Number of successful extensions: 89927
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89897
Number of HSP's gapped (non-prelim): 30
length of query: 504
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 482
effective length of database: 17,147,199,772
effective search space: 8264950290104
effective search space used: 8264950290104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)