ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart46e10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 66 1e-08
2emb|AL162712.16| Human DNA sequence from clone RP11-158A8 on chr... 40 0.61
3gb|AC090897.4| Homo sapiens chromosome 18, clone RP11-61D1, comp... 40 0.61
4gb|AC092643.2| Homo sapiens BAC clone RP11-393P9 from 4, complet... 40 0.61
5gb|AC161285.2| Pan troglodytes BAC clone CH251-310B11 from chrom... 38 2.4
6gb|AC161473.5| Pan troglodytes BAC clone CH251-460F23 from chrom... 38 2.4
7gb|AC000057.1| Homo sapiens BAC clone CTB-67M9 from 7, complete ... 38 2.4
8gb|AC122405.4| Mus musculus BAC clone RP24-119O6 from chromosome... 38 2.4
9gb|AC142302.1| Pan troglodytes BAC clone RP43-128I16 from 7, com... 38 2.4
10gb|AC108863.4| Homo sapiens chromosome 8, clone CTD-2544N14, com... 38 2.4
11gb|AC113133.5| Homo sapiens chromosome 8, clone RP11-930P14, com... 38 2.4
12emb|BX569796.6| Zebrafish DNA sequence from clone CH211-106K21 i... 38 2.4
13gb|AC151582.3| Pan troglodytes BAC clone RP43-3F18 from chromoso... 38 2.4
14gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome 38 2.4
15emb|BX005384.2| Zebrafish DNA sequence from clone DKEY-114E11, c... 38 2.4
16gb|AC067817.10| Homo sapiens chromosome 8, clone RP11-723D22, co... 38 2.4
17gb|U64837.1| Caenorhabditis elegans cosmid T27E4, complete sequence 36 9.5
18gb|AY518321.1| Homo sapiens cell division cycle 27 (CDC27) gene,... 36 9.5
19gb|AC009400.4|ATAC009400 Arabidopsis thaliana chromosome III BAC... 36 9.5
20gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, comple... 36 9.5
21emb|CR388047.20| Zebrafish DNA sequence from clone DKEY-244D13, ... 36 9.5
22emb|Z98049.1|HS427A4 Human DNA sequence from clone RP3-427A4 on ... 36 9.5
23emb|AL606752.11| Human DNA sequence from clone RP11-740C1 on chr... 36 9.5
24emb|AL663023.10| Human DNA sequence from clone RP11-180D21 on ch... 36 9.5
25emb|AL512284.20| Human DNA sequence from clone RP11-248M22 on ch... 36 9.5
26gb|AC079630.18| Homo sapiens 12 BAC RP11-476D10 (Roswell Park Ca... 36 9.5
27gb|AC018711.4| Homo sapiens BAC clone RP11-324K4 from 1, complet... 36 9.5
28gb|AC093422.3| Homo sapiens chromosome 1 clone RP11-383G10, comp... 36 9.5
29ref|XM_392583.2| PREDICTED: Apis mellifera similar to GA15393-PA... 36 9.5
30gb|AC017053.8| Homo sapiens BAC clone RP11-339D8 from 2, complet... 36 9.5
31gb|AC161620.5| Pan troglodytes BAC clone CH251-232H7 from chromo... 36 9.5
32emb|BX000431.10| Zebrafish DNA sequence from clone DKEY-14B11 in... 36 9.5
33gb|AC020626.6|AC020626 Homo sapiens 3 BAC RP11-41F5 (Roswell Par... 36 9.5
34gb|AC124119.7| Mus musculus chromosome 12, clone RP23-220M9, com... 36 9.5
35emb|BX908791.12| Zebrafish DNA sequence from clone DKEY-261H15 i... 36 9.5
36gb|AC153642.7| Mus musculus 6 BAC RP23-334E23 (Roswell Park Canc... 36 9.5
37emb|BX936463.13| Zebrafish DNA sequence from clone DKEY-4G17 in ... 36 9.5
38emb|AL844176.11| Mouse DNA sequence from clone RP23-99O16 on chr... 36 9.5
39gb|AC123705.12| Mus musculus chromosome 12, clone RP23-355K21, c... 36 9.5
40dbj|AK112319.1| Ciona intestinalis cDNA, clone:ciad019c05, full ... 36 9.5
41gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome 36 9.5
42gb|AC134849.5| Mus musculus BAC clone RP24-207G4 from 9, complet... 36 9.5
43gb|AC002558.1|AC002558 Homo sapiens chromosome 17, clone hRPC867... 36 9.5
44emb|CT010451.9| Mouse DNA sequence from clone RP23-103I7 on chro... 36 9.5
45emb|AJ890093.1| alpha proteobacterium endosymbiont 1c of Inanidr... 36 9.5
46gb|AC153640.6| Mus musculus 6 BAC RP23-230A2 (Roswell Park Cance... 36 9.5
47dbj|AB045995.1| Macaca fascicularis brain cDNA, clone:QccE-11742 36 9.5 
>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete cds
          Length = 1343

 Score = 65.9 bits (33), Expect = 1e-08
 Identities = 49/53 (92%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                 
Query: 7    acattggatttcaaatttcccccc-aagttacctggatgggtacatgaaatga 58
            |||||| ||||||||||||||||| |||||||||||||| |||||||| ||||
Sbjct: 1208 acattgcatttcaaatttcccccccaagttacctggatgcgtacatgacatga 1156
to top
>emb|AL162712.16| Human DNA sequence from clone RP11-158A8 on chromosome 13 Contains a
              novel gene, complete sequence
          Length = 115331

 Score = 40.1 bits (20), Expect = 0.61
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 4      aaaacattggatttcaaatt 23
              ||||||||||||||||||||
Sbjct: 100465 aaaacattggatttcaaatt 100484
to top
>gb|AC090897.4| Homo sapiens chromosome 18, clone RP11-61D1, complete sequence
          Length = 157606

 Score = 40.1 bits (20), Expect = 0.61
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    ggtacatgaaatgaaagaac 64
             ||||||||||||||||||||
Sbjct: 45426 ggtacatgaaatgaaagaac 45407
to top
>gb|AC092643.2| Homo sapiens BAC clone RP11-393P9 from 4, complete sequence
          Length = 151902

 Score = 40.1 bits (20), Expect = 0.61
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    aaatttccccccaagttacc 38
             ||||||||||||||||||||
Sbjct: 77542 aaatttccccccaagttacc 77561
to top
>gb|AC161285.2| Pan troglodytes BAC clone CH251-310B11 from chromosome 7, complete
             sequence
          Length = 171038

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 37    cctggatgggtacatgaaa 55
             |||||||||||||||||||
Sbjct: 21077 cctggatgggtacatgaaa 21059
to top
>gb|AC161473.5| Pan troglodytes BAC clone CH251-460F23 from chromosome 7, complete
              sequence
          Length = 170605

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 37     cctggatgggtacatgaaa 55
              |||||||||||||||||||
Sbjct: 105935 cctggatgggtacatgaaa 105917
to top
>gb|AC000057.1| Homo sapiens BAC clone CTB-67M9 from 7, complete sequence
          Length = 78631

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 37    cctggatgggtacatgaaa 55
             |||||||||||||||||||
Sbjct: 38373 cctggatgggtacatgaaa 38391
to top
>gb|AC122405.4| Mus musculus BAC clone RP24-119O6 from chromosome 12, complete sequence
          Length = 196285

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 9      attggatttcaaatttccccccaagtt 35
              |||||||||||||| |||||| |||||
Sbjct: 102461 attggatttcaaatgtcccccaaagtt 102487
to top
>gb|AC142302.1| Pan troglodytes BAC clone RP43-128I16 from 7, complete sequence
          Length = 161986

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 37     cctggatgggtacatgaaa 55
              |||||||||||||||||||
Sbjct: 127485 cctggatgggtacatgaaa 127503
to top
>gb|AC108863.4| Homo sapiens chromosome 8, clone CTD-2544N14, complete sequence
          Length = 199218

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 6     aacattggatttcaaatttcccc 28
             |||||||| ||||||||||||||
Sbjct: 18342 aacattggctttcaaatttcccc 18320
to top
>gb|AC113133.5| Homo sapiens chromosome 8, clone RP11-930P14, complete sequence
          Length = 137390

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 44     gggtacatgaaatgaaaga 62
              |||||||||||||||||||
Sbjct: 101525 gggtacatgaaatgaaaga 101507
to top
>emb|BX569796.6| Zebrafish DNA sequence from clone CH211-106K21 in linkage group 2,
             complete sequence
          Length = 109947

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 39    tggatgggtacatgaaatgaaag 61
             ||||||| |||||||||||||||
Sbjct: 52438 tggatggttacatgaaatgaaag 52460
to top
>gb|AC151582.3| Pan troglodytes BAC clone RP43-3F18 from chromosome 7, complete sequence
          Length = 197992

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 37     cctggatgggtacatgaaa 55
              |||||||||||||||||||
Sbjct: 164451 cctggatgggtacatgaaa 164433
to top
>gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome
          Length = 1767403

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     ctggatgggtacatgaaat 56
              |||||||||||||||||||
Sbjct: 154891 ctggatgggtacatgaaat 154909
to top
>emb|BX005384.2| Zebrafish DNA sequence from clone DKEY-114E11, complete sequence
          Length = 152969

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 39     tggatgggtacatgaaatgaaag 61
              ||||||| |||||||||||||||
Sbjct: 124065 tggatggttacatgaaatgaaag 124087
to top
>gb|AC067817.10| Homo sapiens chromosome 8, clone RP11-723D22, complete sequence
          Length = 172678

 Score = 38.2 bits (19), Expect = 2.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 6      aacattggatttcaaatttcccc 28
              |||||||| ||||||||||||||
Sbjct: 167798 aacattggctttcaaatttcccc 167776
to top
>gb|U64837.1| Caenorhabditis elegans cosmid T27E4, complete sequence
          Length = 34101

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 4     aaaacattggatttcaaa 21
             ||||||||||||||||||
Sbjct: 17980 aaaacattggatttcaaa 17997
to top
>gb|AY518321.1| Homo sapiens cell division cycle 27 (CDC27) gene, complete cds
          Length = 72906

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 4    aaaacattggatttcaaa 21
            ||||||||||||||||||
Sbjct: 8582 aaaacattggatttcaaa 8599
to top
>gb|AC009400.4|ATAC009400 Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence,
             complete sequence
          Length = 87937

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     acattggatttcaaattt 24
             ||||||||||||||||||
Sbjct: 41014 acattggatttcaaattt 41031
to top
>gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, complete sequence
          Length = 185947

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    gatttcaaatttcccccc 30
             ||||||||||||||||||
Sbjct: 87674 gatttcaaatttcccccc 87691
to top
>emb|CR388047.20| Zebrafish DNA sequence from clone DKEY-244D13, complete sequence
          Length = 223119

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 42   atgggtacatgaaatgaa 59
            ||||||||||||||||||
Sbjct: 6808 atgggtacatgaaatgaa 6791
to top
>emb|Z98049.1|HS427A4 Human DNA sequence from clone RP3-427A4 on chromosome 6q26-27 Contains
             the 5' end of the RPS6KA2 gene for ribosomal protein S6
             kinase, 90kD, polypeptide 2 (RSK3), the gene for a novel
             protein and a CpG island, complete sequence
          Length = 149466

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 10    ttggatttcaaatttcccccca 31
             |||||||| |||||||||||||
Sbjct: 81125 ttggattttaaatttcccccca 81146
to top
>emb|AL606752.11| Human DNA sequence from clone RP11-740C1 on chromosome 1 Contains the
            OR10J5 gene for olfactory receptor family 10 subfamily J
            member 5 and an amyloid P component serum (APCS)
            pseudogene, complete sequence
          Length = 87134

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 5    aaacattggatttcaaat 22
            ||||||||||||||||||
Sbjct: 1163 aaacattggatttcaaat 1146
to top
>emb|AL663023.10| Human DNA sequence from clone RP11-180D21 on chromosome 1 Contains an
             olfactory receptor pseudogene, the OR10J1 gene for
             olfactory receptor family 10 subfamily J member 1, a novel
             gene and the 5' end of a novel gene, complete sequence
          Length = 86107

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 5     aaacattggatttcaaat 22
             ||||||||||||||||||
Sbjct: 85270 aaacattggatttcaaat 85253
to top
>emb|AL512284.20| Human DNA sequence from clone RP11-248M22 on chromosome 10 Contains
             part of the gene for CamKI-like protein kinase (CKLiK)
             (LOC221042 LOC283070) and two CpG islands, complete
             sequence
          Length = 113920

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    aaatttccccccaagtta 36
             ||||||||||||||||||
Sbjct: 34126 aaatttccccccaagtta 34109
to top
>gb|AC079630.18| Homo sapiens 12 BAC RP11-476D10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 178388

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 44     gggtacatgaaatgaaag 61
              ||||||||||||||||||
Sbjct: 143247 gggtacatgaaatgaaag 143230
to top
>gb|AC018711.4| Homo sapiens BAC clone RP11-324K4 from 1, complete sequence
          Length = 167334

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 46     gtacatgaaatgaaagaa 63
              ||||||||||||||||||
Sbjct: 145555 gtacatgaaatgaaagaa 145538
to top
>gb|AC093422.3| Homo sapiens chromosome 1 clone RP11-383G10, complete sequence
          Length = 180872

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 46    gtacatgaaatgaaagaa 63
             ||||||||||||||||||
Sbjct: 42406 gtacatgaaatgaaagaa 42423
to top
>ref|XM_392583.2| PREDICTED: Apis mellifera similar to GA15393-PA (LOC409057), mRNA
          Length = 978

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 47  tacatgaaatgaaagaac 64
           ||||||||||||||||||
Sbjct: 526 tacatgaaatgaaagaac 543
to top
>gb|AC017053.8| Homo sapiens BAC clone RP11-339D8 from 2, complete sequence
          Length = 181952

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 8     cattggatttcaaatttc 25
             ||||||||||||||||||
Sbjct: 37151 cattggatttcaaatttc 37168
to top
>gb|AC161620.5| Pan troglodytes BAC clone CH251-232H7 from chromosome unknown, complete
              sequence
          Length = 204271

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 44     gggtacatgaaatgaaag 61
              ||||||||||||||||||
Sbjct: 165341 gggtacatgaaatgaaag 165358
to top
>emb|BX000431.10| Zebrafish DNA sequence from clone DKEY-14B11 in linkage group 15,
             complete sequence
          Length = 200161

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 8     cattggatttcaaatttc 25
             ||||||||||||||||||
Sbjct: 52370 cattggatttcaaatttc 52387
to top
>gb|AC020626.6|AC020626 Homo sapiens 3 BAC RP11-41F5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 170346

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 8      cattggatttcaaatttc 25
              ||||||||||||||||||
Sbjct: 148186 cattggatttcaaatttc 148169
to top
>gb|AC124119.7| Mus musculus chromosome 12, clone RP23-220M9, complete sequence
          Length = 176682

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 4      aaaacattggatttcaaa 21
              ||||||||||||||||||
Sbjct: 168048 aaaacattggatttcaaa 168031
to top
>emb|BX908791.12| Zebrafish DNA sequence from clone DKEY-261H15 in linkage group 18,
             complete sequence
          Length = 66694

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 8     cattggatttcaaatttc 25
             ||||||||||||||||||
Sbjct: 40832 cattggatttcaaatttc 40849
to top
>gb|AC153642.7| Mus musculus 6 BAC RP23-334E23 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 227781

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 45    ggtacatgaaatgaaaga 62
             ||||||||||||||||||
Sbjct: 18800 ggtacatgaaatgaaaga 18817
to top
>emb|BX936463.13| Zebrafish DNA sequence from clone DKEY-4G17 in linkage group 17, complete
              sequence
          Length = 232846

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 4      aaaacattggatttcaaa 21
              ||||||||||||||||||
Sbjct: 207514 aaaacattggatttcaaa 207497
to top
>emb|AL844176.11| Mouse DNA sequence from clone RP23-99O16 on chromosome 4, complete
             sequence
          Length = 143963

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 43    tgggtacatgaaatgaaa 60
             ||||||||||||||||||
Sbjct: 35860 tgggtacatgaaatgaaa 35843
to top
>gb|AC123705.12| Mus musculus chromosome 12, clone RP23-355K21, complete sequence
          Length = 217397

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 4      aaaacattggatttcaaa 21
              ||||||||||||||||||
Sbjct: 115448 aaaacattggatttcaaa 115465
to top
>dbj|AK112319.1| Ciona intestinalis cDNA, clone:ciad019c05, full insert sequence
          Length = 1825

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 29  ccaagttacctggatgggtaca 50
           |||||||||||| |||||||||
Sbjct: 468 ccaagttacctgtatgggtaca 447
to top
>gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome
          Length = 1830138

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 19      aaatttccccccaagtta 36
               ||||||||||||||||||
Sbjct: 1295143 aaatttccccccaagtta 1295160
to top
>gb|AC134849.5| Mus musculus BAC clone RP24-207G4 from 9, complete sequence
          Length = 151630

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 46    gtacatgaaatgaaagaa 63
             ||||||||||||||||||
Sbjct: 22085 gtacatgaaatgaaagaa 22068
to top
>gb|AC002558.1|AC002558 Homo sapiens chromosome 17, clone hRPC867C24, complete sequence
          Length = 102064

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 4     aaaacattggatttcaaa 21
             ||||||||||||||||||
Sbjct: 16258 aaaacattggatttcaaa 16275
to top
>emb|CT010451.9| Mouse DNA sequence from clone RP23-103I7 on chromosome 9, complete
              sequence
          Length = 214871

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 46     gtacatgaaatgaaagaa 63
              ||||||||||||||||||
Sbjct: 135170 gtacatgaaatgaaagaa 135187
to top
>emb|AJ890093.1| alpha proteobacterium endosymbiont 1c of Inanidrilus leukodermatus
           16S rRNA gene, clone Ileu4-91
          Length = 1470

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 22  tttccccccaagttacct 39
           ||||||||||||||||||
Sbjct: 194 tttccccccaagttacct 177
to top
>gb|AC153640.6| Mus musculus 6 BAC RP23-230A2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 208897

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 45     ggtacatgaaatgaaaga 62
              ||||||||||||||||||
Sbjct: 194663 ggtacatgaaatgaaaga 194680
to top
>dbj|AB045995.1| Macaca fascicularis brain cDNA, clone:QccE-11742
          Length = 2355

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 44   gggtacatgaaatgaaag 61
            ||||||||||||||||||
Sbjct: 1511 gggtacatgaaatgaaag 1528


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 765,274
Number of Sequences: 3902068
Number of extensions: 765274
Number of successful extensions: 50036
Number of sequences better than 10.0: 47
Number of HSP's better than 10.0 without gapping: 47
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49961
Number of HSP's gapped (non-prelim): 74
length of query: 64
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 43
effective length of database: 17,151,101,840
effective search space: 737497379120
effective search space used: 737497379120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top