ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart46d06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY543532.1| Triticum aestivum expansin EXPA6 mRNA, complete cds 54 2e-04
2ref|XM_507957.1| PREDICTED: Pan troglodytes similar to hypotheti... 44 0.18
3emb|AL359385.28| Human DNA sequence from clone RP11-375N9 on chr... 44 0.18
4gb|AC002388.3| Arabidopsis thaliana chromosome 2 clone T13E15 ma... 42 0.72
5ref|XM_639832.1| Dictyostelium discoideum hypothetical protein (... 40 2.8
6gb|AC149289.1| Solanum demissum chromosome 11 clone PGEC417F14 m... 40 2.8
7gb|AC160339.2| Mus musculus BAC clone RP23-410O11 from chromosom... 40 2.8
8gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, com... 40 2.8
9gb|AC163664.3| Mus musculus BAC clone RP23-310P18 from chromosom... 40 2.8
10emb|AM087972.1| Sepia smithi mitochondrial partial coxII gene fo... 40 2.8
11ref|XM_734798.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 2.8
12emb|AL646016.8| Human DNA sequence from clone RP11-90L13 on chro... 40 2.8
13emb|CR387977.8| Zebrafish DNA sequence from clone CH211-72D20 in... 40 2.8
14gb|AC021701.8| Homo sapiens chromosome 18, clone RP11-704G7, com... 40 2.8
15gb|AC136376.3| Mus musculus BAC clone RP23-243M12 from 14, compl... 40 2.8

>gb|AY543532.1| Triticum aestivum expansin EXPA6 mRNA, complete cds
          Length = 844

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 50/55 (90%), Gaps = 2/55 (3%)
 Strand = Plus / Minus

                                                                  
Query: 146 tctggatagttccatgcatgttcgccctcaacgaagcgaactgat-atagtaata 199
           |||||| |||| |||||||||||||||| |||| ||||||||||| |||||||||
Sbjct: 840 tctggagagtttcatgcatgttcgccctgaacg-agcgaactgataatagtaata 787



to top

>ref|XM_507957.1| PREDICTED: Pan troglodytes similar to hypothetical protein
           (LOC450648), mRNA
          Length = 814

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 193 agtaatagtaatacaaattata 214
           ||||||||||||||||||||||
Sbjct: 479 agtaatagtaatacaaattata 500



to top

>emb|AL359385.28| Human DNA sequence from clone RP11-375N9 on chromosome 10 Contains the
             gene for a novel protein (MGC14258), a CD164 antigen,
             sialomucin (CD164) pseudogene and two CpG islands,
             complete sequence
          Length = 99408

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 193   agtaatagtaatacaaattata 214
             ||||||||||||||||||||||
Sbjct: 64999 agtaatagtaatacaaattata 64978



to top

>gb|AC002388.3| Arabidopsis thaliana chromosome 2 clone T13E15 map m336, complete
             sequence
          Length = 85534

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 137   cgtctggactctggatagttc 157
             |||||||||||||||||||||
Sbjct: 30472 cgtctggactctggatagttc 30452



to top

>ref|XM_639832.1| Dictyostelium discoideum hypothetical protein (DDB0219949), partial
           mRNA
          Length = 2718

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 atagtaatagtaatacaaat 210
           ||||||||||||||||||||
Sbjct: 254 atagtaatagtaatacaaat 273



to top

>gb|AC149289.1| Solanum demissum chromosome 11 clone PGEC417F14 map MAP_LOC, complete
             sequence
          Length = 46168

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   tatagtaatagtaatacaaa 209
             ||||||||||||||||||||
Sbjct: 33711 tatagtaatagtaatacaaa 33692



to top

>gb|AC160339.2| Mus musculus BAC clone RP23-410O11 from chromosome 9, complete sequence
          Length = 174612

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    aattcaaatctactggtgcc 81
             ||||||||||||||||||||
Sbjct: 94313 aattcaaatctactggtgcc 94332



to top

>gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, complete sequence
          Length = 186258

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     atttacaattcaaatctact 75
              ||||||||||||||||||||
Sbjct: 122280 atttacaattcaaatctact 122299



to top

>gb|AC163664.3| Mus musculus BAC clone RP23-310P18 from chromosome 14, complete sequence
          Length = 221930

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 20     tcctttaataactatagggatggg 43
              |||||||||||||||||| |||||
Sbjct: 167624 tcctttaataactataggcatggg 167601



to top

>emb|AM087972.1| Sepia smithi mitochondrial partial coxII gene for cytochrome
          oxidase II, from Australia
          Length = 334

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 15 aataatcctttaataactat 34
          ||||||||||||||||||||
Sbjct: 26 aataatcctttaataactat 45



to top

>ref|XM_734798.1| Plasmodium chabaudi chabaudi hypothetical protein (PC402023.00.0)
           partial mRNA
          Length = 64

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 191 atagtaatagtaatacaaattata 214
           ||||||||||||||| ||||||||
Sbjct: 30  atagtaatagtaatagaaattata 53



to top

>emb|AL646016.8| Human DNA sequence from clone RP11-90L13 on chromosome 1 Contains the
             3' end of the FMN2 gene for formin 2, complete sequence
          Length = 76813

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 195   taatagtaatacaaattata 214
             ||||||||||||||||||||
Sbjct: 30101 taatagtaatacaaattata 30120



to top

>emb|CR387977.8| Zebrafish DNA sequence from clone CH211-72D20 in linkage group 24,
             complete sequence
          Length = 167396

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 191   atagtaatagtaatacaaat 210
             ||||||||||||||||||||
Sbjct: 52872 atagtaatagtaatacaaat 52891



to top

>gb|AC021701.8| Homo sapiens chromosome 18, clone RP11-704G7, complete sequence
          Length = 170311

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 45    ggggattacagatttacaattcaa 68
             |||||||||||| |||||||||||
Sbjct: 88055 ggggattacagaattacaattcaa 88078



to top

>gb|AC136376.3| Mus musculus BAC clone RP23-243M12 from 14, complete sequence
          Length = 197646

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 20    tcctttaataactatagggatggg 43
             |||||||||||||||||| |||||
Sbjct: 14025 tcctttaataactataggcatggg 14002


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,774,853
Number of Sequences: 3902068
Number of extensions: 1774853
Number of successful extensions: 135991
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 135961
Number of HSP's gapped (non-prelim): 30
length of query: 222
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 200
effective length of database: 17,147,199,772
effective search space: 3429439954400
effective search space used: 3429439954400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top