ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart46b04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY857762.1| Triticum monococcum peroxidase 8 (POX8) mRNA, com... 94 2e-16
2gb|AC168204.1| Medicago truncatula chromosome 7 BAC clone mth2-6... 42 0.73
3gb|AC136974.11| Medicago truncatula clone mth2-22e9, complete se... 42 0.73
4gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, c... 42 0.73
5gb|AY106338.1| Zea mays PCO074336 mRNA sequence 42 0.73
6ref|XM_670697.1| Plasmodium berghei strain ANKA hypothetical pro... 40 2.9
7gb|AC182808.1| Gasterosteus aculeatus clone VMRC28-105K03, compl... 40 2.9
8gb|AC113326.9| Mus musculus chromosome 1, clone RP23-454G7, comp... 40 2.9

>gb|AY857762.1| Triticum monococcum peroxidase 8 (POX8) mRNA, complete cds
          Length = 1282

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                        
Query: 118  agtataggcgcgaacggacaccgactaaccagcacgcccgtgcattggcattcaagcacc 177
            |||||| | |||||||||||||||| | |||||||||||||||||| ||||||||| || 
Sbjct: 1201 agtatacgtgcgaacggacaccgaccagccagcacgcccgtgcattcgcattcaaggacg 1142

                                                           
Query: 178  cacacatcaggccatggcgaccttgtcgtgcgaacccgggcggcgga 224
            || ||||||| || |||||||||| ||||  || ||||| |||||||
Sbjct: 1141 catacatcagcccttggcgaccttatcgtcggagcccggtcggcgga 1095



to top

>gb|AC168204.1| Medicago truncatula chromosome 7 BAC clone mth2-64h15, complete
             sequence
          Length = 45758

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 16    ttattatttttgctcaattaa 36
             |||||||||||||||||||||
Sbjct: 12268 ttattatttttgctcaattaa 12288



to top

>gb|AC136974.11| Medicago truncatula clone mth2-22e9, complete sequence
          Length = 124037

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 16    ttattatttttgctcaattaa 36
             |||||||||||||||||||||
Sbjct: 11525 ttattatttttgctcaattaa 11505



to top

>gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, complete sequence
          Length = 178059

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 20    tatttttgctcaattaacaac 40
             |||||||||||||||||||||
Sbjct: 79311 tatttttgctcaattaacaac 79291



to top

>gb|AY106338.1| Zea mays PCO074336 mRNA sequence
          Length = 849

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 69 gaaagggcatttcagcaaact 89
          |||||||||||||||||||||
Sbjct: 56 gaaagggcatttcagcaaact 36



to top

>ref|XM_670697.1| Plasmodium berghei strain ANKA hypothetical protein (PB103910.00.0)
            partial mRNA
          Length = 3190

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 15   attattatttttgctcaatt 34
            ||||||||||||||||||||
Sbjct: 1392 attattatttttgctcaatt 1373



to top

>gb|AC182808.1| Gasterosteus aculeatus clone VMRC28-105K03, complete sequence
          Length = 124886

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 63     ccatcggaaagggcatttca 82
              ||||||||||||||||||||
Sbjct: 120343 ccatcggaaagggcatttca 120324



to top

>gb|AC113326.9| Mus musculus chromosome 1, clone RP23-454G7, complete sequence
          Length = 192734

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      catgccacattattattttt 26
              ||||||||||||||||||||
Sbjct: 105697 catgccacattattattttt 105716


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,223,113
Number of Sequences: 3902068
Number of extensions: 2223113
Number of successful extensions: 150322
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 150305
Number of HSP's gapped (non-prelim): 17
length of query: 225
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 203
effective length of database: 17,147,199,772
effective search space: 3480881553716
effective search space used: 3480881553716
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top