ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart45e03 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_468409.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1290 Score = 119 bits (60), Expect = 8e-24 Identities = 195/240 (81%) Strand = Plus / Minus Query: 185 gcttcatctgtacgactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 244 |||||||||||| |||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1053 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 994 Query: 245 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 304 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 993 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 934 Query: 305 gctttctttggtggccccggtgatcacggacgacacgttggggttagacgcgcaccacgc 364 | ||||||| ||||| || |||||||| || || ||||| ||||| || ||||||||||| Sbjct: 933 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 874 Query: 365 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 424 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 873 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 814
>ref|XM_507048.1| PREDICTED Oryza sativa (japonica cultivar-group), P0643F09.35 mRNA Length = 1331 Score = 119 bits (60), Expect = 8e-24 Identities = 195/240 (81%) Strand = Plus / Minus Query: 185 gcttcatctgtacgactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 244 |||||||||||| |||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1100 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 1041 Query: 245 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 304 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 1040 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 981 Query: 305 gctttctttggtggccccggtgatcacggacgacacgttggggttagacgcgcaccacgc 364 | ||||||| ||||| || |||||||| || || ||||| ||||| || ||||||||||| Sbjct: 980 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 921 Query: 365 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 424 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 920 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 861
>dbj|AK104135.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-E11, full insert sequence Length = 1290 Score = 119 bits (60), Expect = 8e-24 Identities = 195/240 (81%) Strand = Plus / Minus Query: 185 gcttcatctgtacgactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 244 |||||||||||| |||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1053 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 994 Query: 245 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 304 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 993 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 934 Query: 305 gctttctttggtggccccggtgatcacggacgacacgttggggttagacgcgcaccacgc 364 | ||||||| ||||| || |||||||| || || ||||| ||||| || ||||||||||| Sbjct: 933 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 874 Query: 365 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 424 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 873 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 814
>dbj|AK072707.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139I11, full insert sequence Length = 1329 Score = 119 bits (60), Expect = 8e-24 Identities = 195/240 (81%) Strand = Plus / Minus Query: 185 gcttcatctgtacgactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 244 |||||||||||| |||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1098 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 1039 Query: 245 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 304 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 1038 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 979 Query: 305 gctttctttggtggccccggtgatcacggacgacacgttggggttagacgcgcaccacgc 364 | ||||||| ||||| || |||||||| || || ||||| ||||| || ||||||||||| Sbjct: 978 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 919 Query: 365 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 424 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 918 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 859
>gb|U46758.1|OSU46758 Oryza sativa potassium channel beta subunit protein (KOB1) mRNA, complete cds Length = 1293 Score = 119 bits (60), Expect = 8e-24 Identities = 195/240 (81%) Strand = Plus / Minus Query: 185 gcttcatctgtacgactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 244 |||||||||||| |||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 1047 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 988 Query: 245 caggacctccggagtcagcagcgggacgacctccagggccttcatgttctccacgatctg 304 | ||| || || || |||||||| | ||| || |||||||||||||| || || ||||| Sbjct: 987 gacgacttctggggttagcagcggaatgacatcgagggccttcatgttttcaacaatctg 928 Query: 305 gctttctttggtggccccggtgatcacggacgacacgttggggttagacgcgcaccacgc 364 | ||||||| ||||| || |||||||| || || ||||| ||||| || ||||||||||| Sbjct: 927 gttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcaccacgc 868 Query: 365 gatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgttcac 424 |||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| ||||| Sbjct: 867 gatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccattcac 808
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 63.9 bits (32), Expect = 4e-07 Identities = 89/108 (82%) Strand = Plus / Minus Query: 185 gcttcatctgtacgactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 244 |||||||||||| |||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 35090838 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 35090779 Query: 245 caggacctccggagtcagcagcgggacgacctccagggccttcatgtt 292 | ||| || || || |||||||| | ||| || |||||||||||||| Sbjct: 35090778 gacgacttctggggttagcagcggaatgacatcgagggccttcatgtt 35090731 Score = 61.9 bits (31), Expect = 2e-06 Identities = 100/123 (81%) Strand = Plus / Minus Query: 302 ctggctttctttggtggccccggtgatcacggacgacacgttggggttagacgcgcacca 361 |||| ||||||| ||||| || |||||||| || || ||||| ||||| || |||||||| Sbjct: 35090600 ctggttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcacca 35090541 Query: 362 cgcgatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgtt 421 ||||||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| || Sbjct: 35090540 cgcgatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccatt 35090481 Query: 422 cac 424 ||| Sbjct: 35090480 cac 35090478
>dbj|AP005111.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0643F09 Length = 161001 Score = 63.9 bits (32), Expect = 4e-07 Identities = 89/108 (82%) Strand = Plus / Minus Query: 185 gcttcatctgtacgactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 244 |||||||||||| |||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 151179 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 151120 Query: 245 caggacctccggagtcagcagcgggacgacctccagggccttcatgtt 292 | ||| || || || |||||||| | ||| || |||||||||||||| Sbjct: 151119 gacgacttctggggttagcagcggaatgacatcgagggccttcatgtt 151072 Score = 61.9 bits (31), Expect = 2e-06 Identities = 100/123 (81%) Strand = Plus / Minus Query: 302 ctggctttctttggtggccccggtgatcacggacgacacgttggggttagacgcgcacca 361 |||| ||||||| ||||| || |||||||| || || ||||| ||||| || |||||||| Sbjct: 150941 ctggttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcacca 150882 Query: 362 cgcgatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgtt 421 ||||||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| || Sbjct: 150881 cgcgatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccatt 150822 Query: 422 cac 424 ||| Sbjct: 150821 cac 150819
>dbj|AP004028.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1136_C12 Length = 103973 Score = 63.9 bits (32), Expect = 4e-07 Identities = 89/108 (82%) Strand = Plus / Minus Query: 185 gcttcatctgtacgactcgaggcgcttgggcttgctctggatgaccgcctcgatcttctc 244 |||||||||||| |||||| |||||| |||||||| |||| ||||| |||||||| || Sbjct: 64001 gcttcatctgtatgactcggtgcgcttcggcttgctttggaccaccgcttcgatcttgtc 63942 Query: 245 caggacctccggagtcagcagcgggacgacctccagggccttcatgtt 292 | ||| || || || |||||||| | ||| || |||||||||||||| Sbjct: 63941 gacgacttctggggttagcagcggaatgacatcgagggccttcatgtt 63894 Score = 61.9 bits (31), Expect = 2e-06 Identities = 100/123 (81%) Strand = Plus / Minus Query: 302 ctggctttctttggtggccccggtgatcacggacgacacgttggggttagacgcgcacca 361 |||| ||||||| ||||| || |||||||| || || ||||| ||||| || |||||||| Sbjct: 63763 ctggttttcttttgtggctccagtgatcacagatgagacgtttgggttcgatgcgcacca 63704 Query: 362 cgcgatacccagctgggccatcgagaccccgagctcggaagcgatcggtttgagcccgtt 421 ||||||| | || ||||| | ||| || || ||||| ||||| || ||||| ||||| || Sbjct: 63703 cgcgatagcaagttgggctaacgaaacaccaagctcagaagcaattggttttagcccatt 63644 Query: 422 cac 424 ||| Sbjct: 63643 cac 63641
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Plus Query: 231 gcctcgatcttctccaggacctccggagtcag 262 |||||||||||||||||| ||||||| ||||| Sbjct: 2745672 gcctcgatcttctccaggtcctccggcgtcag 2745703
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 agcgggacgacctccagggc 283 |||||||||||||||||||| Sbjct: 2108047 agcgggacgacctccagggc 2108028
>emb|CR543861.1| Acinetobacter sp. ADP1 complete genome Length = 3598621 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 cgcttgggcttgctctggat 226 |||||||||||||||||||| Sbjct: 1509558 cgcttgggcttgctctggat 1509577
>emb|BX511268.5| Zebrafish DNA sequence from clone CH211-66B9 in linkage group 2, complete sequence Length = 167067 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 37 acaacaaaatgtttcacacg 56 |||||||||||||||||||| Sbjct: 109056 acaacaaaatgtttcacacg 109075
>gb|AC097498.3| Homo sapiens BAC clone RP11-326N15 from 4, complete sequence Length = 144511 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 131 ggaaaaaatcccaccatgtg 150 |||||||||||||||||||| Sbjct: 65537 ggaaaaaatcccaccatgtg 65518
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 aaaaatcccaccatgtggag 153 |||||||||||||||||||| Sbjct: 16548368 aaaaatcccaccatgtggag 16548349
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome Length = 1849742 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 ccagggccttcatgttctcc 296 |||||||||||||||||||| Sbjct: 1068533 ccagggccttcatgttctcc 1068552
>dbj|AP005628.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1014_E02 Length = 159669 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 aaaaatcccaccatgtggag 153 |||||||||||||||||||| Sbjct: 20192 aaaaatcccaccatgtggag 20173
>gb|AE017221.1| Thermus thermophilus HB27, complete genome Length = 1894877 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 ccagggccttcatgttctcc 296 |||||||||||||||||||| Sbjct: 741511 ccagggccttcatgttctcc 741530 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,206,652 Number of Sequences: 3902068 Number of extensions: 3206652 Number of successful extensions: 55983 Number of sequences better than 10.0: 17 Number of HSP's better than 10.0 without gapping: 17 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 55730 Number of HSP's gapped (non-prelim): 253 length of query: 439 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 417 effective length of database: 17,147,199,772 effective search space: 7150382304924 effective search space used: 7150382304924 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
