ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart45c11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL355595.10| Human DNA sequence from clone RP11-276G3 on chr... 42 0.83
2gb|AC133514.4| Mus musculus BAC clone RP23-212F6 from chromosome... 40 3.3
3gb|AC123844.4| Mus musculus BAC clone RP23-416P14 from chromosom... 40 3.3
4gb|AC116659.3| Mus musculus BAC clone RP24-147E15 from 7, comple... 40 3.3
5gb|AY279847.1| Pteragogus cryptus Tmo-4C4 (Tmo-4C4) gene, partia... 40 3.3
6dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.3
7gb|AC128737.4| Mus musculus BAC clone RP23-99A8 from chromosome ... 40 3.3
8gb|AC159742.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 3.3
9emb|BX649615.6| Mouse DNA sequence from clone RP23-273I8 on chro... 40 3.3
10dbj|AP005299.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.3
11gb|AY509272.1| Uncultured Flavobacteriales bacterium clone LiUU-... 40 3.3

>emb|AL355595.10| Human DNA sequence from clone RP11-276G3 on chromosome 13 Contains a
             novel gene and a novel pseudogene, complete sequence
          Length = 119343

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 9     actttataaaaaatgatgcactcca 33
             |||||| ||||||||||||||||||
Sbjct: 46627 actttaaaaaaaatgatgcactcca 46651



to top

>gb|AC133514.4| Mus musculus BAC clone RP23-212F6 from chromosome 5, complete sequence
          Length = 208083

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 31     ccagttatgtgatagtacaa 50
              ||||||||||||||||||||
Sbjct: 151512 ccagttatgtgatagtacaa 151531



to top

>gb|AC123844.4| Mus musculus BAC clone RP23-416P14 from chromosome 7, complete sequence
          Length = 198721

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   gacaagggatggtgacttcc 169
             ||||||||||||||||||||
Sbjct: 48446 gacaagggatggtgacttcc 48465



to top

>gb|AC116659.3| Mus musculus BAC clone RP24-147E15 from 7, complete sequence
          Length = 140476

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   gacaagggatggtgacttcc 169
             ||||||||||||||||||||
Sbjct: 95685 gacaagggatggtgacttcc 95704



to top

>gb|AY279847.1| Pteragogus cryptus Tmo-4C4 (Tmo-4C4) gene, partial cds
          Length = 475

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 146 taatgacaagggatggtgac 165
           ||||||||||||||||||||
Sbjct: 114 taatgacaagggatggtgac 133



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 101      aggatacaatagcaacacca 120
                ||||||||||||||||||||
Sbjct: 18542704 aggatacaatagcaacacca 18542723



to top

>gb|AC128737.4| Mus musculus BAC clone RP23-99A8 from chromosome unknown, complete
              sequence
          Length = 211960

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    tataagaaactatctcctgc 189
              ||||||||||||||||||||
Sbjct: 157626 tataagaaactatctcctgc 157645



to top

>gb|AC159742.1| Ornithorhynchus anatinus chromosome UNK clone OABb-263A1, complete
             sequence
          Length = 150582

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    gatagtacaatacaacagag 60
             ||||||||||||||||||||
Sbjct: 55765 gatagtacaatacaacagag 55746



to top

>emb|BX649615.6| Mouse DNA sequence from clone RP23-273I8 on chromosome X, complete
             sequence
          Length = 88938

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   tataagaaactatctcctgc 189
             ||||||||||||||||||||
Sbjct: 76626 tataagaaactatctcctgc 76607



to top

>dbj|AP005299.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1789_D08
          Length = 128673

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   aggatacaatagcaacacca 120
             ||||||||||||||||||||
Sbjct: 83843 aggatacaatagcaacacca 83862



to top

>gb|AY509272.1| Uncultured Flavobacteriales bacterium clone LiUU-3-244 16S
           ribosomal RNA gene, partial sequence
          Length = 724

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 124 ggtgttctgtgtaataatct 143
           ||||||||||||||||||||
Sbjct: 680 ggtgttctgtgtaataatct 661


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,344,568
Number of Sequences: 3902068
Number of extensions: 2344568
Number of successful extensions: 37454
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37428
Number of HSP's gapped (non-prelim): 26
length of query: 254
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 232
effective length of database: 17,147,199,772
effective search space: 3978150347104
effective search space used: 3978150347104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top