>gb|AC147907.2| Xenopus tropicalis clone CH216-74C22, complete sequence
          Length = 184109

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 40     tttcatgagaaataaattccc 60
              |||||||||||||||||||||
Sbjct: 148514 tttcatgagaaataaattccc 148494

>gb|AC147837.2| Xenopus tropicalis clone CH216-28I17, complete sequence
          Length = 181178

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 40    tttcatgagaaataaattccc 60
             |||||||||||||||||||||
Sbjct: 46159 tttcatgagaaataaattccc 46179

>dbj|AK024838.1| Homo sapiens cDNA: FLJ21185 fis, clone CAS11646
          Length = 674

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 23  cttggttaacctttccgttt 42
           ||||||||||||||||||||
Sbjct: 417 cttggttaacctttccgttt 398

>emb|AL954329.7| Zebrafish DNA sequence from clone CH211-226C11 in linkage group 23,
             complete sequence
          Length = 194284

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    tttcatgagaaataaattcc 59
             ||||||||||||||||||||
Sbjct: 10168 tttcatgagaaataaattcc 10187

>ref|NM_125823.2| Arabidopsis thaliana unknown protein AT5G64270 mRNA, complete cds
          Length = 4146

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 3    tgaagacgctctcatggac 21
            |||||||||||||||||||
Sbjct: 3543 tgaagacgctctcatggac 3561

>gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, complete sequence
          Length = 218917

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 30    aacctttccgtttcatgag 48
             |||||||||||||||||||
Sbjct: 79041 aacctttccgtttcatgag 79059

>gb|AC161496.6| Mus musculus chromosome 3, clone RP23-119A9, complete sequence
          Length = 203655

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 30    aacctttccgtttcatgag 48
             |||||||||||||||||||
Sbjct: 34459 aacctttccgtttcatgag 34441

>emb|AL445239.8| Human DNA sequence from clone RP11-540L11 on chromosome X Contains the
             3' end of the CASK gene for calcium/calmodulin-dependent
             serine protein kinase (MAGUK family) and a novel gene,
             complete sequence
          Length = 75677

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    tttcatgagaaataaattc 58
             |||||||||||||||||||
Sbjct: 30692 tttcatgagaaataaattc 30710

>gb|AC092981.3| Homo sapiens 3 BAC RP11-305I9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 160000

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 43    catgagaaataaattccct 61
             |||||||||||||||||||
Sbjct: 39164 catgagaaataaattccct 39182

>ref|NM_166585.2| Drosophila melanogaster Gustatory receptor 59a CG30189-RA (Gr59a),
           mRNA
          Length = 1104

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 16  atggactcttggttaacctttcc 38
           ||||||||||||||||| |||||
Sbjct: 479 atggactcttggttaacatttcc 501

>dbj|AK221391.1| Arabidopsis thaliana mRNA for nuclear protein-like, complete cds,
           clone: RAFL25-43-N10
          Length = 1062

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 3   tgaagacgctctcatggac 21
           |||||||||||||||||||
Sbjct: 512 tgaagacgctctcatggac 530

>gb|AC008352.2|AC008352 Drosophila melanogaster, chromosome 2R, region 59C-59D, BAC clone
              BACR08P09, complete sequence
          Length = 181463

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 16     atggactcttggttaacctttcc 38
              ||||||||||||||||| |||||
Sbjct: 119326 atggactcttggttaacatttcc 119348

>emb|BX950767.1| Gallus gallus finished cDNA, clone ChEST816e20
          Length = 1131

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 32  cctttccgtttcatgagaa 50
           |||||||||||||||||||
Sbjct: 805 cctttccgtttcatgagaa 787

>emb|BX831020.1|CNS09ZEK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS4ZF06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1263

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 3   tgaagacgctctcatggac 21
           |||||||||||||||||||
Sbjct: 712 tgaagacgctctcatggac 730

>dbj|AB008268.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1
          Length = 83594

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     tgaagacgctctcatggac 21
             |||||||||||||||||||
Sbjct: 35106 tgaagacgctctcatggac 35124

>gb|AE003459.3| Drosophila melanogaster chromosome 2R, section 67 of 73 of the complete
              sequence
          Length = 283700

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 16     atggactcttggttaacctttcc 38
              ||||||||||||||||| |||||
Sbjct: 185139 atggactcttggttaacatttcc 185161


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 920,324
Number of Sequences: 3902068
Number of extensions: 920324
Number of successful extensions: 65650
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65628
Number of HSP's gapped (non-prelim): 22
length of query: 156
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 134
effective length of database: 17,147,199,772
effective search space: 2297724769448
effective search space used: 2297724769448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)