>gb|AC117231.4| Mus musculus BAC clone RP23-394M5 from 8, complete sequence
          Length = 195936

 Score = 40.1 bits (20), Expect = 0.86
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 49     acaagctgaccaaacccccacttt 72
              |||||||||||||| |||||||||
Sbjct: 168480 acaagctgaccaaaaccccacttt 168503

>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete
               sequence
          Length = 1194300

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 58      ccaaacccccacttttgactggc 80
               |||||||||||||||||| ||||
Sbjct: 1110998 ccaaacccccacttttgattggc 1111020

>ref|XM_572219.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNH00260) partial mRNA
          Length = 1771

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 58  ccaaacccccacttttgactggc 80
           |||||||||||||||||| ||||
Sbjct: 703 ccaaacccccacttttgattggc 681

>emb|BX571866.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
              8/17
          Length = 349652

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 21     caagcctctaagtataattcctg 43
              ||||||||||| |||||||||||
Sbjct: 330570 caagcctctaaatataattcctg 330548


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 529,498
Number of Sequences: 3902068
Number of extensions: 529498
Number of successful extensions: 29253
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29249
Number of HSP's gapped (non-prelim): 4
length of query: 82
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 61
effective length of database: 17,151,101,840
effective search space: 1046217212240
effective search space used: 1046217212240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)