Clone Name | rbart44e07 |
---|---|
Clone Library Name | barley_pub |
>gb|AF061282.1| Sorghum bicolor 22 kDa kafirin cluster Length = 162249 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 329 ttcttaccgatcccaataagcgcctccatgttctctttggtggcgatatccaccga 384 ||||| ||||||||||| || |||||||||||||| || || ||||| |||||||| Sbjct: 74035 ttcttcccgatcccaatcagtgcctccatgttctccttcgtcgcgatgtccaccga 73980 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 181 ggagttgaggttggtttggcgcagcttgcgctcctcggagagcctcttggcgaa 234 |||||||||||||| ||||| ||| | ||||| ||||||||| |||||||||| Sbjct: 74183 ggagttgaggttggcctggcgtagcctccgctcgtcggagagcatcttggcgaa 74130 Score = 46.1 bits (23), Expect = 0.097 Identities = 41/47 (87%) Strand = Plus / Plus Query: 335 ccgatcccaataagcgcctccatgttctctttggtggcgatatccac 381 ||||||||||| || | |||||||||||| ||||| ||||| ||||| Sbjct: 41867 ccgatcccaatcagagactccatgttctccttggtcgcgatgtccac 41913
>gb|AC154479.2| Mus musculus BAC clone RP24-135I6 from chromosome 9, complete sequence Length = 153964 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Plus Query: 153 ttcttcgtctctcttctcttctct 176 |||||||||||||||||||||||| Sbjct: 73555 ttcttcgtctctcttctcttctct 73578
>gb|AC120885.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0042J05, complete sequence Length = 150295 Score = 44.1 bits (22), Expect = 0.38 Identities = 43/50 (86%) Strand = Plus / Minus Query: 335 ccgatcccaataagcgcctccatgttctctttggtggcgatatccaccga 384 |||||||| || || |||||||||||||| | || |||||||||||||| Sbjct: 22459 ccgatcccgatcagtgcctccatgttctcctccgtcgcgatatccaccga 22410
>gb|AC134878.3| Homo sapiens BAC clone RP11-131M6 from Y, complete sequence Length = 155813 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 acaatcataaatcataattattaaag 101 |||||||||||||| ||||||||||| Sbjct: 19350 acaatcataaatcagaattattaaag 19325
>gb|AC134882.2| Homo sapiens BAC clone RP11-886I11 from Y, complete sequence Length = 152654 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 acaatcataaatcataattattaaag 101 |||||||||||||| ||||||||||| Sbjct: 138756 acaatcataaatcagaattattaaag 138731
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.38 Identities = 43/50 (86%) Strand = Plus / Minus Query: 335 ccgatcccaataagcgcctccatgttctctttggtggcgatatccaccga 384 |||||||| || || |||||||||||||| | || |||||||||||||| Sbjct: 23006456 ccgatcccgatcagtgcctccatgttctcctccgtcgcgatatccaccga 23006407
>dbj|AK067827.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013120O20, full insert sequence Length = 2434 Score = 44.1 bits (22), Expect = 0.38 Identities = 43/50 (86%) Strand = Plus / Minus Query: 335 ccgatcccaataagcgcctccatgttctctttggtggcgatatccaccga 384 |||||||| || || |||||||||||||| | || |||||||||||||| Sbjct: 2050 ccgatcccgatcagtgcctccatgttctcctccgtcgcgatatccaccga 2001
>emb|AL671532.13| Human DNA sequence from clone RP11-512A4 on chromosome 22, complete sequence Length = 211173 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 76 acaatcataaatcataattattaaag 101 |||||||||||||| ||||||||||| Sbjct: 202080 acaatcataaatcagaattattaaag 202055
>gb|AC123027.4| Mus musculus BAC clone RP24-550H11 from 3, complete sequence Length = 191211 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 67 ataactaaaacaatcataaatc 88 |||||||||||||||||||||| Sbjct: 66284 ataactaaaacaatcataaatc 66305
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.38 Identities = 43/50 (86%) Strand = Plus / Minus Query: 335 ccgatcccaataagcgcctccatgttctctttggtggcgatatccaccga 384 |||||||| || || |||||||||||||| | || |||||||||||||| Sbjct: 23316366 ccgatcccgatcagtgcctccatgttctcctccgtcgcgatatccaccga 23316317
>emb|AL731623.3|OSJN00263 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0083D01, complete sequence Length = 148353 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 tctctcttctcttctctacttggag 184 ||||||||||||||||||| ||||| Sbjct: 44129 tctctcttctcttctctacgtggag 44153
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 tctctcttctcttctctacttggag 184 ||||||||||||||||||| ||||| Sbjct: 18462774 tctctcttctcttctctacgtggag 18462798
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 tctctcttctcttctctactt 180 ||||||||||||||||||||| Sbjct: 7088983 tctctcttctcttctctactt 7089003 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 tctctcttctcttctctact 179 |||||||||||||||||||| Sbjct: 19662657 tctctcttctcttctctact 19662638
>dbj|AP005003.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0495C02 Length = 151467 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 tctctcttctcttctctactt 180 ||||||||||||||||||||| Sbjct: 92402 tctctcttctcttctctactt 92422
>gb|AC147240.3| Mus musculus BAC clone RP23-398F20 from 10, complete sequence Length = 195921 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 aaaacaatcataaatcataat 93 ||||||||||||||||||||| Sbjct: 83818 aaaacaatcataaatcataat 83838
>gb|AC102081.15| Mus musculus chromosome 18, clone RP23-43H5, complete sequence Length = 245125 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 164 tcttctcttctctacttggagttg 187 |||||||||||||| ||||||||| Sbjct: 9753 tcttctcttctctagttggagttg 9730
>gb|DP000016.1| Pan troglodytes target 1 genomic scaffold Length = 1623484 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 tcgtctctcttctcttctct 176 |||||||||||||||||||| Sbjct: 1156231 tcgtctctcttctcttctct 1156212
>gb|DQ125486.1| Toxoplasma gondii structural maintenance of chromosome 2 (SMC2) gene, complete cds Length = 18600 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 cttcttcgtctctcttctct 171 |||||||||||||||||||| Sbjct: 4108 cttcttcgtctctcttctct 4127
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 40.1 bits (20), Expect = 6.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 394 gagcgagtcgtcctggatgcgcaggtag 421 ||||| |||||||||||||||| ||||| Sbjct: 3322205 gagcgcgtcgtcctggatgcgctggtag 3322178
>ref|XM_713538.1| Candida albicans SC5314 hypothetical protein (CaO19_7473), mRNA Length = 2274 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 83 taaatcataattattaaagt 102 |||||||||||||||||||| Sbjct: 939 taaatcataattattaaagt 920
>gb|AC091637.1| Pan troglodytes clone RP43-176G10, complete sequence Length = 51190 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 tcgtctctcttctcttctct 176 |||||||||||||||||||| Sbjct: 18933 tcgtctctcttctcttctct 18914
>gb|AC164304.2| Mus musculus BAC clone RP23-261B24 from chromosome 14, complete sequence Length = 184690 Score = 40.1 bits (20), Expect = 6.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 152 cttcttcgtctctcttctcttctctact 179 |||||| ||||| ||||||||||||||| Sbjct: 123572 cttcttggtctcacttctcttctctact 123599
>gb|AC002465.1| Homo sapiens BAC clone CTA-343P13 from 7, complete sequence Length = 155881 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 tcgtctctcttctcttctct 176 |||||||||||||||||||| Sbjct: 15403 tcgtctctcttctcttctct 15384
>emb|CR788304.8| Zebrafish DNA sequence from clone DKEY-56J15 in linkage group 2, complete sequence Length = 20264 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 72 taaaacaatcataaatcata 91 |||||||||||||||||||| Sbjct: 3279 taaaacaatcataaatcata 3260
>gb|AC139757.4| Mus musculus BAC clone RP23-440H11 from chromosome 18, complete sequence Length = 193847 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 164 tcttctcttctctacttggagttg 187 |||||||||||||| ||||||||| Sbjct: 149059 tcttctcttctctagttggagttg 149036
>gb|AC115298.6| Mus musculus BAC clone RP23-224G24 from X, complete sequence Length = 184032 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 tcgtctctcttctcttctct 176 |||||||||||||||||||| Sbjct: 160377 tcgtctctcttctcttctct 160358
>gb|AC093889.2| Homo sapiens BAC clone RP11-671G14 from 7, complete sequence Length = 198453 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 281 tacatcccattgtcaatgtt 300 |||||||||||||||||||| Sbjct: 169133 tacatcccattgtcaatgtt 169114
>gb|AC108781.9| Mus musculus, clone RP23-304K14, complete sequence Length = 183718 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 aactaaaacaatcataaatcataa 92 |||||||| ||||||||||||||| Sbjct: 135487 aactaaaataatcataaatcataa 135510
>emb|AL161420.10| Human DNA sequence from clone RP11-155N3 on chromosome 13 Contains the 3' end of the gene for zizimin1 (KIAA1058) and a novel gene, complete sequence Length = 163316 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 181 ggagttgaggttggtttggc 200 |||||||||||||||||||| Sbjct: 94703 ggagttgaggttggtttggc 94684
>emb|AL137125.7| Human DNA sequence from clone RP11-175E13 on chromosome 9p23-24.3 Contains part of the PTPRD gene for protein tyrosine phosphatase, receptor type, D (HPTP, PTPD, HPTPD), complete sequence Length = 92384 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 153 ttcttcgtctctcttctcttctct 176 |||||| ||||||||||||||||| Sbjct: 12746 ttcttcttctctcttctcttctct 12769
>emb|AL772234.5| Mouse DNA sequence from clone RP23-413M22 on chromosome 11, complete sequence Length = 193528 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 153 ttcttcgtctctcttctcttctct 176 |||||| ||||||||||||||||| Sbjct: 111070 ttcttcttctctcttctcttctct 111047
>emb|AL929014.28| Zebrafish DNA sequence from clone CH211-198B3 in linkage group 20 Contains the gene for a novel protein similar to vertebrate fibronectin type III domain containing 1 (FNDC1), the 5' end of the gene for a novel protein similar to vertebrate otoferlin (OTOF), a novel gene and two CpG islands, complete sequence Length = 163523 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 157 tcgtctctcttctcttctct 176 |||||||||||||||||||| Sbjct: 58942 tcgtctctcttctcttctct 58961
>emb|BX321910.6| Zebrafish DNA sequence from clone DKEYP-25B4 in linkage group 7, complete sequence Length = 167869 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 aatcataaatcataattatt 97 |||||||||||||||||||| Sbjct: 124459 aatcataaatcataattatt 124478
>gb|AC015563.11| Homo sapiens chromosome 18, clone RP11-344B2, complete sequence Length = 214984 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 tctctcttctcttctctacttgga 183 ||||| |||||||||||||||||| Sbjct: 44813 tctctgttctcttctctacttgga 44836
>gb|AC011825.13| Homo sapiens chromosome 18, clone RP11-53I6, complete sequence Length = 176222 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 tctctcttctcttctctacttgga 183 ||||| |||||||||||||||||| Sbjct: 136657 tctctgttctcttctctacttgga 136680
>gb|AC153370.13| Mus musculus 10 BAC RP23-281M13 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 213550 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 ctctcttctcttctctactt 180 |||||||||||||||||||| Sbjct: 71523 ctctcttctcttctctactt 71542
>gb|AC149040.2| Medicago truncatula chromosome 7 BAC clone mth2-9f22, complete sequence Length = 120423 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 153 ttcttcgtctctcttctcttctct 176 |||||| ||||||||||||||||| Sbjct: 13700 ttcttcttctctcttctcttctct 13723
>gb|AC156501.3| Mus musculus BAC clone RP23-358M3 from chromosome 14, complete sequence Length = 195115 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 aactaaaacaatcataaatcataa 92 |||||||| ||||||||||||||| Sbjct: 92475 aactaaaataatcataaatcataa 92452
>gb|AC158599.7| Mus musculus 10 BAC RP23-122O12 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 191825 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 ctctcttctcttctctactt 180 |||||||||||||||||||| Sbjct: 32265 ctctcttctcttctctactt 32246
>gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold Length = 1787293 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 tcgtctctcttctcttctct 176 |||||||||||||||||||| Sbjct: 1069048 tcgtctctcttctcttctct 1069029
>gb|DP000026.1| Pongo pygmaeus target 1 genomic scaffold Length = 1819346 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 tcgtctctcttctcttctct 176 |||||||||||||||||||| Sbjct: 1045310 tcgtctctcttctcttctct 1045291
>gb|AC154322.1| Mus musculus BAC clone RP23-299P17 from chromosome 14, complete sequence Length = 182146 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 tctcttctcttctctacttg 181 |||||||||||||||||||| Sbjct: 122252 tctcttctcttctctacttg 122233
>dbj|AB121692.1| Mus musculus peptidylarginine deiminase gene cluster (Padi2, Padi1, Padi23, Padi4, Padi6), complete cds Length = 240498 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 157 tcgtctctcttctcttctct 176 |||||||||||||||||||| Sbjct: 37966 tcgtctctcttctcttctct 37985
>gb|AC055863.16| Homo sapiens chromosome 17, clone RP11-478P5, complete sequence Length = 152348 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 155 cttcgtctctcttctcttct 174 |||||||||||||||||||| Sbjct: 118860 cttcgtctctcttctcttct 118879
>gb|AC002130.2|AC002130 Genomic sequence for Arabidopsis thaliana BAC F1N21 from chromosome I, complete sequence Length = 114738 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 154 tcttcgtctctcttctcttc 173 |||||||||||||||||||| Sbjct: 107501 tcttcgtctctcttctcttc 107520
>dbj|AP005798.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1136H02 Length = 145086 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 tctctcttctcttctctact 179 |||||||||||||||||||| Sbjct: 19415 tctctcttctcttctctact 19396
>dbj|AP005110.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0605D08 Length = 144340 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 tctctcttctcttctctact 179 |||||||||||||||||||| Sbjct: 128943 tctctcttctcttctctact 128924
>emb|BX248390.7| Zebrafish DNA sequence from clone DKEY-34F16 in linkage group 20, complete sequence Length = 239874 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 aaaacaatcataaatcataa 92 |||||||||||||||||||| Sbjct: 226201 aaaacaatcataaatcataa 226220
>gb|AC154388.4| Mus musculus BAC clone RP23-14P7 from chromosome 14, complete sequence Length = 246800 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 153 ttcttcgtctctcttctcttctct 176 |||||| ||||||||||||||||| Sbjct: 15949 ttcttcctctctcttctcttctct 15926
>emb|AL732617.24| Mouse DNA sequence from clone RP23-196C23 on chromosome 4, complete sequence Length = 226501 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 cttcttcgtctctcttctct 171 |||||||||||||||||||| Sbjct: 196434 cttcttcgtctctcttctct 196415
>emb|CT010520.15| Mouse DNA sequence from clone RP23-349A19 on chromosome 14, complete sequence Length = 175582 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 153 ttcttcgtctctcttctcttctct 176 |||||| ||||||||||||||||| Sbjct: 37063 ttcttcctctctcttctcttctct 37086
>emb|BX000438.7| Zebrafish DNA sequence from clone CH211-209M20 in linkage group 20, complete sequence Length = 195087 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 aaaacaatcataaatcataa 92 |||||||||||||||||||| Sbjct: 14808 aaaacaatcataaatcataa 14827
>emb|AL645625.15| Mouse DNA sequence from clone RP23-183L1 on chromosome 4, complete sequence Length = 226754 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 tcgtctctcttctcttctct 176 |||||||||||||||||||| Sbjct: 6275 tcgtctctcttctcttctct 6256
>emb|AL583884.20| Mouse DNA sequence from clone RP23-324B16 on chromosome 15, complete sequence Length = 202342 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 tctctcttctcttctctact 179 |||||||||||||||||||| Sbjct: 34878 tctctcttctcttctctact 34897 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,721,267 Number of Sequences: 3902068 Number of extensions: 3721267 Number of successful extensions: 170942 Number of sequences better than 10.0: 54 Number of HSP's better than 10.0 without gapping: 55 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 170381 Number of HSP's gapped (non-prelim): 561 length of query: 444 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 422 effective length of database: 17,147,199,772 effective search space: 7236118303784 effective search space used: 7236118303784 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)