ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart44d12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_186003.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
2emb|AL845360.10| Mouse DNA sequence from clone RP23-421L7 on chr... 48 0.026
3emb|AL606923.8| Human DNA sequence from clone RP11-361F19 on chr... 42 1.6
4gb|AC022905.7| Homo sapiens chromosome 8, clone RP11-656G20, com... 42 1.6
5gb|AC011003.7|AC011003 Homo sapiens chromosome 8 clone RP11-86O1... 42 1.6
6emb|BX004834.13| Zebrafish DNA sequence from clone CH211-42E22 i... 42 1.6
7emb|AL929586.19| Zebrafish DNA sequence from clone CH211-188I17,... 42 1.6
8gb|AC148207.4| Callicebus moloch clone LB5-404B3, complete sequence 40 6.5
9gb|AC123984.14| Mus musculus chromosome 8, clone RP23-78H21, com... 40 6.5
10ref|XM_960955.1| Plasmodium falciparum 3D7 DNA repair protein (r... 40 6.5
11gb|AC146502.2| Danio rerio clone CH211-262M17, complete sequence 40 6.5
12gb|AC122415.4| Mus musculus BAC clone RP24-156A2 from chromosome... 40 6.5
13emb|AL591916.8| Human DNA sequence from clone RP11-168B8 on chro... 40 6.5
14gb|AC022296.34| Homo sapiens 3 BAC RP11-91K8 (Roswell Park Cance... 40 6.5
15emb|CR382398.1| Plasmodium falciparum chromosome 6, complete seq... 40 6.5
16emb|BX901953.5| Zebrafish DNA sequence from clone CH211-18G18 in... 40 6.5
17emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on ch... 40 6.5
18gb|AC129416.1| Homo sapiens 12 BAC RP11-464G3 (Roswell Park Canc... 40 6.5
19emb|BX465189.9| Zebrafish DNA sequence from clone RP71-47G15 in ... 40 6.5
20gb|AC096642.2| Homo sapiens chromosome 1 clone RP11-392O17, comp... 40 6.5
21gb|AC144939.4| Mus musculus BAC clone RP24-137O21 from chromosom... 40 6.5
22gb|AC156286.8| Mus musculus 6 BAC RP24-285N17 (Roswell Park Canc... 40 6.5
23gb|AC005036.1| Homo sapiens BAC clone RP11-364H22 from 2, comple... 40 6.5
24gb|AC006560.8| Homo sapiens 12 BAC RPCI11-792F18 (Roswell Park C... 40 6.5
25gb|AC007539.8| Homo sapiens 12 BAC RCPI11-935C2 (Roswell Park Ca... 40 6.5
26gb|AC139365.3| Homo sapiens chromosome 8, clone RP11-643N23, com... 40 6.5
27gb|AC137719.5| Homo sapiens chromosome 8, clone RP11-260I22, com... 40 6.5
28emb|BX322570.4| Zebrafish DNA sequence from clone DKEY-27H10 in ... 40 6.5
29emb|BX005447.8| Zebrafish DNA sequence from clone DKEY-29B14, co... 40 6.5
30emb|BX088551.7| Zebrafish DNA sequence from clone CH211-106A19 i... 40 6.5
31emb|AL844217.7| Zebrafish DNA sequence from clone DKEY-218L17, c... 40 6.5
32gb|AC007447.6|AC007447 Homo sapiens, clone hRPK.76_A_1, complete... 40 6.5
33gb|AC006539.1|AC006539 Homo sapiens chromosome 19, BAC 39498 (CI... 40 6.5
34gb|DP000019.1| Callicebus moloch target 1 genomic scaffold 40 6.5

>ref|NM_186003.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 912

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 299 tcatgtcgatgtcagccctggacacgatcgccctggtgagtgcgtcctcgtccgttccaa 358
           |||||||||| ||||| |  ||||||||  | ||||||||   |||||||| ||| || |
Sbjct: 793 tcatgtcgatctcagcacgcgacacgattactctggtgagcatgtcctcgtacgtcccca 734

                                                         
Query: 359 gtcctaggattgagtacctgataacctctgcaaagtgcttttcagg 404
            ||| | ||| |||| |||||| |||||||||||||| ||||||||
Sbjct: 733 atcccaagatcgagtgcctgatcacctctgcaaagtgtttttcagg 688



to top

>emb|AL845360.10| Mouse DNA sequence from clone RP23-421L7 on chromosome 2, complete
              sequence
          Length = 196651

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 69     aaacaaacaacatgatcaactgatgcaa 96
              ||||||| ||||||||||||||||||||
Sbjct: 125340 aaacaaaaaacatgatcaactgatgcaa 125367



to top

>emb|AL606923.8| Human DNA sequence from clone RP11-361F19 on chromosome 6 Contains a C2H2
              zinc finger protein pseudogene, complete sequence
          Length = 154285

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 384    ctctgcaaagtgcttttcagg 404
              |||||||||||||||||||||
Sbjct: 130091 ctctgcaaagtgcttttcagg 130111



to top

>gb|AC022905.7| Homo sapiens chromosome 8, clone RP11-656G20, complete sequence
          Length = 184311

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 154    gatgagaaatgaaaattttgt 174
              |||||||||||||||||||||
Sbjct: 143733 gatgagaaatgaaaattttgt 143713



to top

>gb|AC011003.7|AC011003 Homo sapiens chromosome 8 clone RP11-86O15, complete sequence
          Length = 189042

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 154   gatgagaaatgaaaattttgt 174
             |||||||||||||||||||||
Sbjct: 39525 gatgagaaatgaaaattttgt 39505



to top

>emb|BX004834.13| Zebrafish DNA sequence from clone CH211-42E22 in linkage group 18,
              complete sequence
          Length = 188895

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 118    tttatttgatgcaaacaccaa 138
              |||||||||||||||||||||
Sbjct: 164047 tttatttgatgcaaacaccaa 164027



to top

>emb|AL929586.19| Zebrafish DNA sequence from clone CH211-188I17, complete sequence
          Length = 154808

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 64    ttcccaaacaaacaacatgat 84
             |||||||||||||||||||||
Sbjct: 72777 ttcccaaacaaacaacatgat 72797



to top

>gb|AC148207.4| Callicebus moloch clone LB5-404B3, complete sequence
          Length = 175081

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 175    ttcaatcttcactccttccctacc 198
              |||||||||||||||||| |||||
Sbjct: 107826 ttcaatcttcactccttcactacc 107849



to top

>gb|AC123984.14| Mus musculus chromosome 8, clone RP23-78H21, complete sequence
          Length = 256723

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 157    gagaaatgaaaattttgttt 176
              ||||||||||||||||||||
Sbjct: 221680 gagaaatgaaaattttgttt 221661



to top

>ref|XM_960955.1| Plasmodium falciparum 3D7 DNA repair protein (rad50) partial mRNA
          Length = 6711

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 155  atgagaaatgaaaattttgt 174
            ||||||||||||||||||||
Sbjct: 6175 atgagaaatgaaaattttgt 6156



to top

>gb|AC146502.2| Danio rerio clone CH211-262M17, complete sequence
          Length = 134798

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    gcatgatgagaaatgaaaat 169
              ||||||||||||||||||||
Sbjct: 118434 gcatgatgagaaatgaaaat 118453



to top

>gb|AC122415.4| Mus musculus BAC clone RP24-156A2 from chromosome 16, complete sequence
          Length = 173829

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 158   agaaatgaaaattttgtttc 177
             ||||||||||||||||||||
Sbjct: 64328 agaaatgaaaattttgtttc 64347



to top

>emb|AL591916.8| Human DNA sequence from clone RP11-168B8 on chromosome 1 Contains the 5'
              end of a novel gene (FLJ36179), complete sequence
          Length = 159159

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 151    catgatgagaaatgaaaatt 170
              ||||||||||||||||||||
Sbjct: 152118 catgatgagaaatgaaaatt 152099



to top

>gb|AC022296.34| Homo sapiens 3 BAC RP11-91K8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 153650

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tggtctttccacatggaata 31
             ||||||||||||||||||||
Sbjct: 29318 tggtctttccacatggaata 29337



to top

>emb|CR382398.1| Plasmodium falciparum chromosome 6, complete sequence; segment 1/5
          Length = 349418

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 155    atgagaaatgaaaattttgt 174
              ||||||||||||||||||||
Sbjct: 238344 atgagaaatgaaaattttgt 238363



to top

>emb|BX901953.5| Zebrafish DNA sequence from clone CH211-18G18 in linkage group 1,
              complete sequence
          Length = 170758

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 120    tatttgatgcaaacaccaatatct 143
              ||||||||||||||||||| ||||
Sbjct: 149072 tatttgatgcaaacaccaaaatct 149049



to top

>emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on chromosome 4 Contains a
             novel gene and the 3' end of a novel gene, complete
             sequence
          Length = 196097

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   actcttgcttgatcatcttc 300
             ||||||||||||||||||||
Sbjct: 29016 actcttgcttgatcatcttc 29035



to top

>gb|AC129416.1| Homo sapiens 12 BAC RP11-464G3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 139995

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 152   atgatgagaaatgaaaattt 171
             ||||||||||||||||||||
Sbjct: 63377 atgatgagaaatgaaaattt 63396



to top

>emb|BX465189.9| Zebrafish DNA sequence from clone RP71-47G15 in linkage group 23,
            complete sequence
          Length = 132715

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 150  gcatgatgagaaatgaaaat 169
            ||||||||||||||||||||
Sbjct: 7750 gcatgatgagaaatgaaaat 7769



to top

>gb|AC096642.2| Homo sapiens chromosome 1 clone RP11-392O17, complete sequence
          Length = 179048

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     acacagtgttcccaaacaaa 75
              ||||||||||||||||||||
Sbjct: 100451 acacagtgttcccaaacaaa 100432



to top

>gb|AC144939.4| Mus musculus BAC clone RP24-137O21 from chromosome 8, complete sequence
          Length = 189547

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 157    gagaaatgaaaattttgttt 176
              ||||||||||||||||||||
Sbjct: 175291 gagaaatgaaaattttgttt 175310



to top

>gb|AC156286.8| Mus musculus 6 BAC RP24-285N17 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 180204

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 152    atgatgagaaatgaaaattt 171
              ||||||||||||||||||||
Sbjct: 108446 atgatgagaaatgaaaattt 108465



to top

>gb|AC005036.1| Homo sapiens BAC clone RP11-364H22 from 2, complete sequence
          Length = 199684

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 457    ctgtactgcttcatgtcctc 476
              ||||||||||||||||||||
Sbjct: 100631 ctgtactgcttcatgtcctc 100612



to top

>gb|AC006560.8| Homo sapiens 12 BAC RPCI11-792F18 (Roswell Park Cancer Institute Human
              BAC Library) complete sequence
          Length = 202478

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 180    tcttcactccttccctacca 199
              ||||||||||||||||||||
Sbjct: 156724 tcttcactccttccctacca 156743



to top

>gb|AC007539.8| Homo sapiens 12 BAC RCPI11-935C2 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 177147

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   tcttcactccttccctacca 199
             ||||||||||||||||||||
Sbjct: 31354 tcttcactccttccctacca 31373



to top

>gb|AC139365.3| Homo sapiens chromosome 8, clone RP11-643N23, complete sequence
          Length = 185549

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     aaacaaacaacatgatcaac 88
              ||||||||||||||||||||
Sbjct: 140743 aaacaaacaacatgatcaac 140762



to top

>gb|AC137719.5| Homo sapiens chromosome 8, clone RP11-260I22, complete sequence
          Length = 171164

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 69   aaacaaacaacatgatcaac 88
            ||||||||||||||||||||
Sbjct: 1545 aaacaaacaacatgatcaac 1564



to top

>emb|BX322570.4| Zebrafish DNA sequence from clone DKEY-27H10 in linkage group 1, complete
              sequence
          Length = 185032

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 120    tatttgatgcaaacaccaatatct 143
              ||||||||||||||||||| ||||
Sbjct: 102620 tatttgatgcaaacaccaaaatct 102643



to top

>emb|BX005447.8| Zebrafish DNA sequence from clone DKEY-29B14, complete sequence
          Length = 283185

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 286    tgcttgatcatcttcatgtc 305
              ||||||||||||||||||||
Sbjct: 133996 tgcttgatcatcttcatgtc 134015



to top

>emb|BX088551.7| Zebrafish DNA sequence from clone CH211-106A19 in linkage group 5,
              complete sequence
          Length = 184417

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 286    tgcttgatcatcttcatgtc 305
              ||||||||||||||||||||
Sbjct: 120967 tgcttgatcatcttcatgtc 120948



to top

>emb|AL844217.7| Zebrafish DNA sequence from clone DKEY-218L17, complete sequence
          Length = 246026

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 120   tatttgatgcaaacaccaatatct 143
             ||||||||||||||||||| ||||
Sbjct: 74694 tatttgatgcaaacaccaaaatct 74717



to top

>gb|AC007447.6|AC007447 Homo sapiens, clone hRPK.76_A_1, complete sequence
          Length = 155210

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 152    atgatgagaaatgaaaattt 171
              ||||||||||||||||||||
Sbjct: 122985 atgatgagaaatgaaaattt 123004



to top

>gb|AC006539.1|AC006539 Homo sapiens chromosome 19, BAC 39498 (CIT-B-26L23), complete sequence
          Length = 114739

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 423   agcaatcttgagcatccttgcaaa 446
             ||||||||||||||||||| ||||
Sbjct: 47913 agcaatcttgagcatcctttcaaa 47890



to top

>gb|DP000019.1| Callicebus moloch target 1 genomic scaffold
          Length = 2105003

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 175     ttcaatcttcactccttccctacc 198
               |||||||||||||||||| |||||
Sbjct: 2037748 ttcaatcttcactccttcactacc 2037771


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,589,744
Number of Sequences: 3902068
Number of extensions: 5589744
Number of successful extensions: 110471
Number of sequences better than 10.0: 34
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 110404
Number of HSP's gapped (non-prelim): 67
length of query: 478
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 456
effective length of database: 17,147,199,772
effective search space: 7819123096032
effective search space used: 7819123096032
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top