ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart44c04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC116503.17| Mus musculus chromosome 9, clone RP24-302M3, com... 44 0.18
2gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complet... 44 0.18
3gb|AC182692.2| Populus trichocarpa clone Pop1-44B2, complete seq... 42 0.71
4gb|BC098091.1| Xenopus tropicalis hypothetical protein mgc108109... 40 2.8
5ref|NM_001032352.1| Xenopus tropicalis hypothetical protein mgc1... 40 2.8
6gb|AC005103.3| Homo sapiens BAC clone CTA-357J21 from 7, complet... 40 2.8
7gb|AF047825.1| Homo sapiens PAC 50H2 in the CUTL1 locus, complet... 40 2.8
8emb|AL023798.1|HS220J16 Human DNA sequence from clone RP6-220J16... 40 2.8
9gb|AC147281.4| Pan troglodytes BAC clone RP43-98P12 from chromos... 40 2.8
10emb|AL935185.11| Zebrafish DNA sequence from clone CH211-250A16 ... 40 2.8
11gb|AC000094.4| Homo sapiens Chromosome 22q11.2 Fosmid Clone f39e... 40 2.8
12gb|AC000085.5| Homo sapiens Chromosome 22q11.2 BAC Clone 72f8 In... 40 2.8
13gb|AC011717.6|AC011717 Arabidopsis thaliana chromosome 1 BAC F19... 40 2.8
14gb|AC096678.4| Pan troglodytes clone RP43-140G16, complete sequence 40 2.8
15gb|AC009322.1|AC009322 Arabidopsis thaliana chromosome I BAC F18... 40 2.8
16gb|AC155638.3| Mus musculus 10 BAC RP24-223J19 (Roswell Park Can... 40 2.8
17emb|AL844169.6| Mouse DNA sequence from clone RP23-322K15 on chr... 40 2.8

>gb|AC116503.17| Mus musculus chromosome 9, clone RP24-302M3, complete sequence
          Length = 199065

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 43   tctgaatttcctaaaaaataaa 64
            ||||||||||||||||||||||
Sbjct: 5339 tctgaatttcctaaaaaataaa 5318



to top

>gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complete sequence
          Length = 196627

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 43    tctgaatttcctaaaaaataaa 64
             ||||||||||||||||||||||
Sbjct: 19476 tctgaatttcctaaaaaataaa 19497



to top

>gb|AC182692.2| Populus trichocarpa clone Pop1-44B2, complete sequence
          Length = 105327

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 74    ttcacactctgtttctctttc 94
             |||||||||||||||||||||
Sbjct: 48443 ttcacactctgtttctctttc 48423



to top

>gb|BC098091.1| Xenopus tropicalis hypothetical protein mgc108109, mRNA (cDNA clone
           MGC:108109 IMAGE:7005112), complete cds
          Length = 3257

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 83  tgtttctctttcagaaattacaaagcat 110
           ||||||||||||||| | ||||||||||
Sbjct: 758 tgtttctctttcagataatacaaagcat 731



to top

>ref|NM_001032352.1| Xenopus tropicalis hypothetical protein mgc108109 (mgc108109), mRNA
          Length = 3257

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 83  tgtttctctttcagaaattacaaagcat 110
           ||||||||||||||| | ||||||||||
Sbjct: 758 tgtttctctttcagataatacaaagcat 731



to top

>gb|AC005103.3| Homo sapiens BAC clone CTA-357J21 from 7, complete sequence
          Length = 146006

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 43    tctgaatttcctaaaaaata 62
             ||||||||||||||||||||
Sbjct: 18186 tctgaatttcctaaaaaata 18205



to top

>gb|AF047825.1| Homo sapiens PAC 50H2 in the CUTL1 locus, complete sequence
          Length = 151964

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 43     tctgaatttcctaaaaaata 62
              ||||||||||||||||||||
Sbjct: 130436 tctgaatttcctaaaaaata 130417



to top

>emb|AL023798.1|HS220J16 Human DNA sequence from clone RP6-220J16 on chromosome Xq26.1-27.3,
             complete sequence
          Length = 108086

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    tttcctaaaaaataaatagc 68
             ||||||||||||||||||||
Sbjct: 53913 tttcctaaaaaataaatagc 53894



to top

>gb|AC147281.4| Pan troglodytes BAC clone RP43-98P12 from chromosome 7, complete
            sequence
          Length = 185963

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   tctgaatttcctaaaaaata 62
            ||||||||||||||||||||
Sbjct: 1182 tctgaatttcctaaaaaata 1163



to top

>emb|AL935185.11| Zebrafish DNA sequence from clone CH211-250A16 in linkage group 21,
              complete sequence
          Length = 191281

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 159    ccataaactcatcccataaa 178
              ||||||||||||||||||||
Sbjct: 118536 ccataaactcatcccataaa 118555



to top

>gb|AC000094.4| Homo sapiens Chromosome 22q11.2 Fosmid Clone f39e1 In DGCR Region,
             complete sequence
          Length = 34335

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 89    tctttcagaaattacaaagc 108
             ||||||||||||||||||||
Sbjct: 29270 tctttcagaaattacaaagc 29289



to top

>gb|AC000085.5| Homo sapiens Chromosome 22q11.2 BAC Clone 72f8 In DGCR Region, complete
             sequence
          Length = 100152

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 89    tctttcagaaattacaaagc 108
             ||||||||||||||||||||
Sbjct: 18417 tctttcagaaattacaaagc 18436



to top

>gb|AC011717.6|AC011717 Arabidopsis thaliana chromosome 1 BAC F19K16 genomic sequence, complete
             sequence
          Length = 111301

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     cattcaaaatcattattagc 22
             ||||||||||||||||||||
Sbjct: 35197 cattcaaaatcattattagc 35178



to top

>gb|AC096678.4| Pan troglodytes clone RP43-140G16, complete sequence
          Length = 95528

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 43   tctgaatttcctaaaaaata 62
            ||||||||||||||||||||
Sbjct: 7426 tctgaatttcctaaaaaata 7445



to top

>gb|AC009322.1|AC009322 Arabidopsis thaliana chromosome I BAC F18B13 genomic sequence,
            complete sequence
          Length = 116905

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    cattcaaaatcattattagc 22
            ||||||||||||||||||||
Sbjct: 5747 cattcaaaatcattattagc 5766



to top

>gb|AC155638.3| Mus musculus 10 BAC RP24-223J19 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 160577

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     aatttcctaaaaaataaata 66
              ||||||||||||||||||||
Sbjct: 107318 aatttcctaaaaaataaata 107299



to top

>emb|AL844169.6| Mouse DNA sequence from clone RP23-322K15 on chromosome 4, complete
             sequence
          Length = 123433

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 54    taaaaaataaatagctatag 73
             ||||||||||||||||||||
Sbjct: 50790 taaaaaataaatagctatag 50771


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,264,653
Number of Sequences: 3902068
Number of extensions: 3264653
Number of successful extensions: 254532
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 254488
Number of HSP's gapped (non-prelim): 44
length of query: 219
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 197
effective length of database: 17,147,199,772
effective search space: 3377998355084
effective search space used: 3377998355084
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top