>gb|AC115733.14| Mus musculus chromosome 16, clone RP23-466L17, complete sequence
          Length = 203973

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 111    aatcaccaccagtgggcagct 131
              |||||||||||||||||||||
Sbjct: 107059 aatcaccaccagtgggcagct 107039

>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete
              sequence
          Length = 1783081

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 199    aaatcaacacacctcgcctt 218
              ||||||||||||||||||||
Sbjct: 276752 aaatcaacacacctcgcctt 276733

>gb|AF488416.1| Zea mays chromosome 9 BAC 9C20 complete sequence
          Length = 143300

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 91     cgcgcggtcttgagaaggtc 110
              ||||||||||||||||||||
Sbjct: 135308 cgcgcggtcttgagaaggtc 135327

>gb|AC132274.3| Mus musculus BAC clone RP24-341I21 from chromosome 3, complete sequence
          Length = 172883

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    gataatgaaatcaacacacc 211
              ||||||||||||||||||||
Sbjct: 117909 gataatgaaatcaacacacc 117928

>gb|AF063851.1|AF063851 Rattus norvegicus vascular chymase (VCH) mRNA, complete cds
          Length = 953

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  agatacaataccatggacca 51
           ||||||||||||||||||||
Sbjct: 684 agatacaataccatggacca 665

>ref|NM_017145.1| Rattus norvegicus mast cell protease 1 (Mcpt1), mRNA
          Length = 953

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  agatacaataccatggacca 51
           ||||||||||||||||||||
Sbjct: 684 agatacaataccatggacca 665


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,149,006
Number of Sequences: 3902068
Number of extensions: 2149006
Number of successful extensions: 34433
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34420
Number of HSP's gapped (non-prelim): 13
length of query: 289
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 267
effective length of database: 17,147,199,772
effective search space: 4578302339124
effective search space used: 4578302339124
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)